Mancha negra de los citricos Guignardia citricarpa

Mancha negra de los citricos

Guignardia citricarpa

_Manchanegra

Científicos ven riesgo de ataque de la “mancha negra” a los cítricos europeos

Comunidad Valenciana | 21/02/2014 – 14:31h

Madrid, 21 feb (EFE).- La Autoridad Europea para la Seguridad Alimentaria (AESA o EFSA) ha alertado hoy, en un informe, del peligro de que las enfermedades de la “mancha negra” o el “cancro” lleguen a la Unión Europea (UE) y se propaguen en sus explotaciones de cítricos.

El grupo de expertos en Sanidad Vegetal de la AESA -agencia con sede en Parma (Italia)- ha determinado que existe el riesgo de que las plantaciones de naranjas, limones, mandarinas, limas o pomelos se vean afectadas por la “mancha negra”, provocada por un hongo, o la plaga del “cancro”.

Actualmente, una de las principales preocupaciones para el sector de cítricos español es el miedo a que ambas plagas contaminen sus producciones; temen especialmente por la posibilidad de la entrada de “mancha negra” a través de los envíos de Sudáfrica.

En la actualidad, ni la “mancha negra” ni el “cancro” están presentes en la UE, donde se aplican medidas de control para evitar su entrada, según el informe.

Los científicos han calificado de “adecuadas” las medidas que se están aplicando en la actualidad a escala comunitaria para impedir su introducción en la UE.

En el estudio, los científicos han señalado que existen “simulaciones” que prueban que la “mancha negra” podría propagarse en las fincas de cítricos europeas a final de verano o en otoño y, en menor medida, al final de la primavera.

El riesgo de introducción de la “mancha negra” está en las importaciones de plantas de cítricos utilizadas para cultivo y en los envíos de frutas con hojas.

Pero como las esporas que produce el hongo que causa la enfermedad se dispersan por el aire, el informe señala que también hay riesgo de contagio a través de la peladura de la fruta.

En cualquier caso, la AESA ha reconocido que hacen falta más estudios sobre el impacto de estas enfermedades.

En el caso de que entraran en una zona que antes no se hubiera visto afectada, las medidas para evitar su propagación serían “limitadas”.

Por este motivo, el grupo de expertos sobre Salud Vegetal considera que se reduzcan los riesgos para evitar la entrada de la en enfermedad.

En cuanto al “cancro”, los expertos ven riesgo de propagación a través de las importaciones de plantas para cultivo u ornamentales y un peligro inferior en el caso de la fruta; en este caso, la AESA es partidaria de prohibir “plantas huésped” para reducir dicha amenaza.

No obstante, según un comunicado, los expertos de la AESA han insistido en que el estudio se hizo asumiendo que el mercado estuviera “sin regular” y sin medidas fitosanitarias.

Leermás: http://www.lavanguardia.com/local/valencia/20140221/54402430486/cientificos-ven-riesgo-de-ataque-de-la-mancha-negra-a-los-citricos-europeos.html#ixzz2v1EIx4mO

Documentos técnicos

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 5.0/5 (1 vote cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

App Gestion Integrada de Plagas y Enfermedades de Citricos

App Gestion Integrada de Plagas

y Enfermedades de Citricos

No dude en consultarnos 963252569 Asesoria en Produccion Integrada inscrita en el Registro Oficial de Productores y Operadores (ROPO)

Puedes comprar nuestro cuaderno de explotacion integrada en excel por

59 € IVA incluido

Pago por transferencia bancaria y envio por correo electronico.

El próximo día 29 de enero se celebrará, en el salón de actos del Instituto Valenciano de Investigaciones Agrarias, la presentación de la nueva aplicación para smartphones donde, además de toda la información disponible en la web, se presentan varias novedades como el cálculo de grados-día en tiempo real para las principales plagas y el sistema de estación de avisos para Alternaria que serán de gran utilidad para el técnico de campo.

También la nueva web (http://gipcitricos.ivia.es) ha ampliado su contenido con una sección sobre las principales enfermedades fúngicas de los cítricos y herramientas para el cálculo de los volúmenes de aplicación de fitosanitarios y la calibración de turboatomizadores.

Información e inscripción para la asistencia: IVIA
Teléfono: 96 342 40 00
Ctra. Moncada-Náquera km. 4,5. 46113 Moncada – VALENCIA
Confirmar asistencia. Plazas limitadas.

Tríptico informativo

Jornada IVIA

La gestión integrada de plagas (GIP) es una estrategia de control que consiste básicamente en la aplicación racional de una combinación de medidas biológicas, biotecnológicas,  químicas, de cultivo o de selección de vegetales, de modo que la utilización de productos fitosanitarios se limite al mínimo necesario. Estas medidas de control se deben combinar de forma inteligente con el fin de mantener los niveles poblacionales de los fitófagos plaga por debajo de sus umbrales económicos de daños (UED). En la actualidad, la GIP es la estrategia de control preferida prácticamente en la mayor parte de cultivos, tanto por motivos de eficacia, como sociales, económicos y medioambientales. Actualmente, todas las Comunidades Autónomas donde se cultivan cítricos disponen de reglamentos de Producción Integrada de cítricos en donde se establecen las bases de la GIP.

En 2008, según fuentes del Ministerio de Medio Ambiente y Medio Rural y Marino (MARM), un 13,6% de la superficie citrícola española se gestionó de acuerdo a los reglamentos de la Producción Integrada, mientras que el 1,5% lo hizo de acuerdo a los de la Agricultura Ecológica. Se estima que estas cifras irán en aumento en el futuro, y en consecuencia también la implantación de tácticas de control biológico. Además, la recientemente aprobada Directiva 2009/128/CE del Parlamento Europeo y del Consejo de 21 de octubre de 2009, por la que se establece el marco de la actuación comunitaria para conseguir un uso sostenible de los plaguicidas, propone, entre otros aspectos, que la aplicación de los principios generales de la GIP sea obligatoria para todos los productores europeos a partir del 1 de enero de 2014.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 5.0/5 (3 votes cast)
VN:F [1.9.22_1171]
Rating: +2 (from 2 votes)

Mejor momento para recolectar una naranja mandarina limon pomelo

Mejor momento para recolectar una naranja mandarina limon pomelo

El mejor momento de recolectar un citrico depende de tres factores principales:

1) Que tenga el máximo de volumen de zumo caracteristico de esa variedad

Como se si mis citricos tienen el máximo de volumen de zumo caracteristico de esa variedad? Es lo primero que debo de averiguar en http://www.ivia.es/variedades/ buscaré la variedad y averiguaré su porcentaje de zumo.

Ahora cogeré varios frutos al azar en el arbol, 15-20 frutos, los pesaré, los exprimiré y los volvere a pesar, por un lado el zumo y por otro la corteza, con eso sabré en que porcentajes de zumo están mis frutos, a mas zumo, mas peso, mas kilos y mas rentabilidad.

La cantidad de zumo en los frutos cítricos, para su comercialización, vienen determinada por los siguientes parámetros:

  • – Clementinas → 40%
  • – Satsumas, naranjas y mandarinas híbridas → 33%
  • – Limones → 20%

2) Que el color sea lo mas atractivo posible

Es bien conocido que la corteza del fruto y el fruto maduran de manera independiente.

¿Cómo puede medirse el color de un citrico?

– Por apreciación visual directa, que para llevarla a cabo, se realiza con la colaboración de varias personas, para corregir los factores subjetivos que hemos comentado.

– Mediante colorímetros, que se basan en:

  • o Sistemas de coordenadas básicas (X Y Z)
  • o Sistemas CIE de cromaticidad
  • o Sistemas basados en colores opuestos
    • ” Sistema CIELAB
    • ” Sistemas HUNTER Lab

– Escalas basadas en los sistemas colorímetros. Uno de los sistemas más utilizados es el de HUNTER Lab.

De todas las formas, el sistema más práctico, es la comparación de los frutos con escalas preestablecidas, que corresponden a tonos de color aceptados generalmente, ya que los  colorímetros no están, en la mayoría de los casos, al alcance técnico ni económico de los almacenes.

Referencias de índices de color (Fuente: IVIA)

Cítricos Limones
Verde intenso IC < -7 IC ≤ -10
Predomina el verde -7 < IC < 0 -5 < IC < 0
Predomina el amarillo 0 < IC < +7 IC ≈ 0
Color comercial IC ≥ 6 0 < IC < +5

Tabla color 2Cuando esto ocurre, es decir el % de azucares en el fruto es el adecuado para su recolección pero el fruto todavia está verde podemos acudir a las técnicas de desverdización jugando con la temperatura y el etileno, forzando el viraje del color, mediante la descomposición de las clorofilas y la sintesis de los carotenoides. Para que los cítricos cambien de color se deben dar los saltos térmicos necesarios para la oxidación de la clorofila, es decir la pérdida del color verde y la aparición de los colores naranjas y rojos, es decir la síntesis de carotenoides. Para que este efecto comience a producirse las temperaturas medias deben superar los 22º y disminuir por debajo de los 18º.

A continuación pongo las recomendaciones que Dña. Alejandra Salvador del Centro de Postcosecha del IVIA recomienda.

Tabla color 4Tabla color 3A continuación os pongo la tabla de colores para mandarina completa

Tabla color mandarina

Podeis ver en este post  que nos dice la norma de calidad de citricos frente al color de los citricos. http://www.tecnicoagricola.es/requisitos-de-calidad-en-color-para-frutos-citricos/

Resumiendo el color es importantisimo en la comercialización hay existen calibradores automaticos de color con una precisión alucinante, si este no se ha alcanzado, podemos desverdizar los frutos.

Cefrupal (Chile)´04 024

3) Que el Indice de madurez sea el adecuado

Que es el índice de madurez? Por qué es importante?

Que una naranja aparte de ser bonita esté buena es fundamental, y… como calificariamos que esté buena? bueno pues hay una relación entre lo dulce y lo acido, que digamos es agradable, lo que se salga de esos parametros resulta desagradable. La grafica llamada “Lengua de Pritchett” marca esos valores.

pritchettSi nuestros valores se situan dentro de la lengua resultaran agradables sino no. Debemos pues hacer que esten ahí dentro, este será parte de nuestro exito comercial.

¿Que es el indice de madurez?

Los cítricos, son frutos en los que predominan en su composición, los glúcidos (glucosa y sacarosa). Al no contener almidón, no cabe la posibilidad, de que se transforme en azúcares más simples durante el estocaje o la conservación, por lo cual no pueden mejorar su calidad interna. Tal como se recolectan llegan al consumidor. Únicamente los limones, una vez recolectados, aumentan con el tiempo la cantidad de zumo.

P1000234Refractómetro automatico, midel el % de azucares en un líquido

Refractómetro manual, más básico pero efectivo y práctico

La forma más habitual, de medir la madurez interna de un fruto cítrico, es mediante el índice de madurez (IM):

IM = E / A

E = ºBrix indicados en el refractometro / (cc de NaOH x 0,128)

Donde E, corresponde a la mayor parte de sólidos solubles del zumo, compuesto por azúcares mayoritariamente. Se mide con un refractómetro y se expresa en grados Brix.

El parámetro A, corresponde a la mayor parte de acidez del zumo, expresado en gramos de ácido cítrico por litro de zumo. Se mide mediante la valoración con NaOH (0,1 N), utilizando fenoltaleína como indicador.

Que es la fenoftaleina?

Podeis verlo en la wikipedia pero basicamente es un indicador de color que cambia de color a determinado pH, osea acidez. Si medimos la cantidad de alcali que necesitamos sabremos que acidez tenemos

Indicamos a continuación, para las distintas variedades, el IM mínimo exigidos para su comercialización:

  • – Satsumas, naranjas (tempranas y de media campaña) → E/A = 6.0
  • – Clementinas y naranjas tardías → E/A = 6.5
  • – Mandarina Fortune → E/A = 8.0

Para mas profundidad sobre el indice de madurez ver este post especifico

Un ejemplo

1) Cojo el zumo de una mandarina mido sus º Brix en el refractometro y me da 16º Brix

2) Pongo en un vaso 5 ml de zumo, ayudandome de una pipeta y le añado una gota de fenoftaleina.

3) En ese vaso voy echado NaoH 0,1 Normal y mido cuanto tengo que echar hasta el viraje de color, apunto ese dato, por ejemplo 20 ml.

Pues bien es muy sencillo, el índice de madurez (IM):

IM = E / A

E = ºBrix indicados en el refractometro

A= (cc de NaOH x 0,128)

IM= 16 / (20 x 0,128) = 6,25

Nuestro indice de madurez será 6,25 sin unidades el IM no tiene unidades.

¿Por qué multiplico por 0,128?

Determinar la acidez de un zumo es fijar la riqueza en acidos expresándola en un número de gramos contenidos en un litro del mismo. la determinación de esa acidez se hace por volumetría; esto es neutralizando la solución acida mediante un alcalí, en este caso hidróxido sódico 0,1 N. Cada cc de hidróxido sódico 0,1 N contiene 0,004 gramos. de este cuerpo, y cada centímetro cúbico de ácido cítrico también 0,1 N, 0,0064 gramos de éste. El ácido cítrico es el metílico-3 pentanol-3 dióxico, cuya fórmula es

CH2 – COOH
|
COH – COOH
|
CH2 – COOH

Es tribasico y cuyo peso molecular es 192,124  luego

192,124/3= 6,4041 gr por litro es el contenido de ácido en una solución 0,1N.

Si tomamos 5 cc entonces dividiremos esa cantidad por 500

6,4041/500= 0,01280008 es decir 0,0128 por cc osea reducido a litros 12,8 para obtener el número de gr contenidos en el litro.

Este es un sistema rápido para conocer, con bastante precisión, la madurez interna de los cítricos.

Por si alguien no lo tiene todavia claro le pongo un video

Imagen de previsualización de YouTube

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 5.0/5 (2 votes cast)
VN:F [1.9.22_1171]
Rating: +1 (from 1 vote)

Fitoftora en citricos

Fitoftora en citricos. Phytophthora citrophthora

Phytophthora citrophthora

Estamos en la epoca en la que es posible que se den las condiciones favorables para el desarrollo de este hongo (lluvias, temperaturas suaves) para el desarrollo del hongo Phytophthora causante del aguado, se recomienda realizar tratamientos preventivos.

Phytophthora citrophthora
Tratar hasta la altura de 1 m. aproximadamente, sobre todo en aquellas parcelas que tengan las frutas bajas y no haya hierba en el suelo. Si no se ha podido realizar dicho tratamiento preventivo se aconseja una aplicación con un fungicida sistémico no más tarde de 48 horas después de la lluvia.

Phytophthora citrophthora
Productos preventivos: compuestos de cobre, mancozeb.
Productos sistémicos: etil fosfito de aluminio, metalaxil (naranja), metalaxil-M.

Cuando el hongo ataca al tronco se pueden observar exudaciones gomosas o heridas en la parte basal del tronco. Puede afectar también a ramas principales donde se aprecian exudaciones de goma en amplias zonas, la enfermedad avanza rápidamente si se dan condiciones favorables provocando la muerte de las ramas afectadas. En las hojas aparece una decoloración y amarilleamiento del nervio principal.
Evitar encharcamiento y favorecer el drenaje de la parcela.
Limpiar la zona dañada y tratarla con oxicloruro de cobre (también se puede aplicar de forma preventiva al tronco y ramas principales).

Phytophthora citrophthora

Tratamientos foliares con etil fosfito de aluminio o en gránulo al suelo con metalaxil o metalaxil-M.

Síntomas: La enfermedad más grave causada por Phytophthora spp. es la gomosis, también conocida como podredumbre del pie. La infección de la planta tiene lugar a nivel de la tierra, produciendo lesiones que se extienden hacia abajo hasta la unión del injerto sobre patrones resistentes, o hacia arriba del tronco hasta las ramas importantes del árbol. La corteza interior y el cambium son dañados, pero la corteza exterior permanece firme con pequeñas grietas a través de las cuales exuda abundante goma. La goma de los cítricos es soluble en agua y desaparece tras fuertes lluvias en climas subtropicales, pero la goma es persistente en el tronco en condiciones secas. Las lesiones se extienden alrededor de la circunferencia del tronco, matando al cambium y anillando lentamente al árbol. Los árboles afectados gravemente tienen las hojas de color verde pálido, con nervios amarillos, como corresponde a un efecto típico del anillado. Si la lesión cesa su expansión o si el hongo muere, el área afectada se rodea de un callo cicatricial y comienza a sanar. Los árboles de vivero y las plantaciones jóvenes con pequeñas circunferencias de tronco pueden ser estrangulados rápidamente y morir. Los árboles adultos pueden morirse pero, por lo general, sólo resultan anillados parcialmente y los daños producen un decaimiento de la copa, con defoliación, muerte de ramas jóvenes y escaso crecimiento de brotes. En los patrones susceptibles, la infección puede desarrollarse por debajo de la línea del suelo, y se desarrollan síntomas en la copa antes de que sean evidentes los daños en la parte aérea del tronco.

Phytophthora citrophthora

La pudrición de la raíz por Phytophthora causa una disminución lenta de la vitalidad del árbol. Las hojas se tornan de color verde claro o amarillo y este puede caer. La enfermedad destruye las raíces de conexión de los portainjertos sensibles. El patógeno infecta la corteza de la raíz, que se vuelve blanda. Si la destrucción de raíces de alimentación se produce más rápido que su regeneración, la absorción de agua y nutrientes será muy limitada. El árbol crecerá mal, reservas de energía almacenadas se agotan, y la producción se reducirá.

Los síntomas de la enfermedad son a menudo difíciles de distinguir de los nematodos, la sal, o del daño por inundación; sólo un análisis de laboratorio pueden proporcionar una identificación positiva.

COMENTARIOS SOBRE LA ENFERMEDAD

Especies de Phytophthora están presentes en la mayoría de los huertos de cítricos. Ellos pueden sobrevivir a condiciones adversas como las esporas persistentes en el suelo. En condiciones de humedad, se producen un gran número de zoosporas móviles, que pueden nadar en el agua y alcanzar distancias cortas. Las zoosporas son los agentes infecciosos que se desarrollan en el riego o el agua de lluvia a las raíces.

Phytophthora citrophthora es una pudrición de la raíz de invierno que también causa la pudrición de la fruta marrón y gomosis. Phytophthora citrophthora está activa durante las estaciones frías, cuando las raíces de cítricos son inactivas y su resistencia a la infección es baja. Phytophthora parasitica está activo durante el tiempo cálido cuando las raíces están creciendo.

GESTIÓN

Gestión de la podredumbre de la raíz por Phytophthora implica el uso de portainjertos resistentes,  la gestión del riego, el uso de fungicidas y la fumigación.

Control Cultural
Proveer drenaje adecuado del suelo y evitar el exceso de riego. Si la destrucción de las raíces absorbentes es mínima, la acción correctiva puede incluir el aumento de las frecuencias de riego, el cambio a riego alterno fila central o un sistema de riego diferente, como Mini-aspersores..

Portainjertos resistentes
Cuando la replantación o el establecimiento de nuevas plantaciones, elija portainjertos resistentes siempre que sea posible, sino también considerar la tolerancia a otras enfermedades, nematodos, y el frío. Los portainjertos más tolerantes son las naranjas trifoliadas

Los métodos orgánicamente aceptables
Los controles culturales y el uso de portainjertos resistentes son métodos aceptables de manejo en una plantación de cítricos manejo orgánico.

Monitoreo y Tratamiento de Decisiones
Si un árbol que crece en portainjertos susceptible parece estresado, cavar un poco de tierra y comprobar las raíces alimenticias. Ataque de P. parasitica durante julio a septiembre, y P. citrophthora durante enero a marzo. Poblaciones superiores de 15 a 20 propágulos por gramo de raíz  pueden requerir tratamiento. Cuando la plantación o replantación en suelo infestado con Phytophthora, o cuando portainjertos susceptible tiene que ser utilizado, la fumigación puede ser factible si no persisten otras condiciones adversas.

Antes de sembrar

a. metam sodio

b. cloropicrina

después de sembrar

a. mefenoxam (ridomil gold)

b. fosetil-al (aliette)

 

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.1/5 (19 votes cast)
VN:F [1.9.22_1171]
Rating: +7 (from 9 votes)

Enfermedad de la impietratura de los citricos o manchas en citricos

Enfermedad de la impietratura de los citricos o manchas en citricos.

Impietratura de los citricos o manchas de los citricos

Impietratura de los citricos o manchas de los citricos

Taxonomía:

Supuesta etiología viral.

Citopatología:

Se produce acumulación de goma en zonas aisladas del albedo o la columela del fruto

Huéspedes:

Cítricos. Afecta a la mayor parte de las especies y variedades cultivadas, si bien algunas son portadoras asintomáticas.

Sintomatología:

La enfermedad afecta fundamentalmente al fruto y el síntoma  característico es la formación de bolsas de goma en el albedo, y a veces en la columela, sin alcanzar la pulpa. En el momento del cambio de color del fruto las zonas afectadas permanecen de color verde, a veces como manchas protuberantes y otras planas. Cuando el fruto madura estas zonas cambian a color pardo y normalmente aparecen deprimidas. Los frutos pueden quedar deformados y de tamaño pequeño, y a veces caen al final del verano. En hojas jóvenes se pueden observar flecos cloróticos y manchas en forma de hoja de roble.

Los árboles afectados parecen normales durante la mayor parte del año, pero puede mostrar marchitez leve, similar a la escasez de agua, durante el verano. Los síntomas característicos de la enfermedad incluyen la caída del fruto, una reducción en el tamaño del fruto, endurecimiento de la piel de los frutos, y engomado del albedo .

Impietratura de los citricos o manchas de los citricos

Los síntomas pueden variar según la estación y con diferentes especies de cítricos y variedades. La enfermedad puede ser detectada en los frutos afectados de variedades susceptibles cuando los frutos son por lo menos 1.5-2 cm de diámetro. Un halo amarillo que rodea a una pequeña área, con glándulas marrones que se pueden ver en frutos infectados, estas áreas pueden convertirse en protuberancias de color amarillo cuando los frutos se agrandan. Muchos de ellos caerán del arbol en un corto periodo de tiempo.

Las áreas afectadas pueden ponerse de color verde durante la maduración. Las protuberancias pueden desaparecer a medida que la madurez avance en las frutas. Podemos cortar o pelar la fruta observando bolsitas llenas de líquido o de goma coagulada. Otras frutos son afectados deformando el fruto en forma de pera y de calibre más pequeño de acuerdo con la gravedad de la infección. En este caso, el engomado sólo puede ser detectada por el corte o pelado de los frutos, y se produce en el albedo alrededor de la fruta, bajo el cáliz, y, con menor frecuencia, en los haces vasculares del eje central.

Impietratura de los citricos o manchas de los citricos

Con menor frecuencia, pequeñas áreas de la corteza parecen deprimidas y de color verde pálido, mientras que las áreas circundantes permanecen ligeramente prominentes, de color verde oscuro y parece deprimidas después de la maduración. No hay síntomas específicos  en las hojas y también se ha observado en Sicilia y Córcega que el tronco, las ramas y retoños de las plantas afectadas no muestran ningún cambio morfológico.

Transmisión:

Por yemas infectadas.

Prevención y Control

Con el fin de evitar la introducción o la propagación de la enfermedad, solamente deberemos usar injertos procedentes de un sistema de produccion certificado. Cualquier árbol existente de una colección de germoplasma debe ser indexado. Los clones infectados pueden ser recuperados por microinjerto.

Impietratura de los citricos o manchas de los citricos

Distribución geográfica:

Distribuida en las zonas citrícolas del Mediterráneo y Oriente Medio.

También se ha detectado en India, Sudáfrica, Texas y Venezuela.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 1.0/5 (1 vote cast)
VN:F [1.9.22_1171]
Rating: +2 (from 2 votes)

Enfermedades o patogenos mas importartes en postcosecha de citricos

Enfermedades o patogenos mas importartes en postcosecha de citricos

Entre los hongos causantes de las elevadas pérdidas en las centrales hortofrutícolas, citaremos los siguientes.

  • PENICILLIUM DIGITATUM (Moho verde) Y PENICILLIUM ITALICUM (Moho azul)
  • ALTERNARIA CITRI
  • BOTRYTIS CINEREA
  • GEOTRICHUM CANDIDUM
  • PHYTOPHTHORA CITROPHTHORA
  • PHOMOPSIS
  • DIPLODIA
  • RHIZOPUS NIGRICANS
  • TRICHOTECIUM ROSEUM
  • COLLETOTRICHUM GLOEOSPORIOIDES
  • FUSARIUM OXYSPORUM
  • CLADOSPORIUM HERBARUM
  • TRICHODERMA

PENICILLIUM DIGITATUM (Moho verde) Y PENICILLIUM ITALICUM (Moho azul)

El podrido producido por este tipo de hongos, es el más conocido y el que más se ve en nuestros almacenes. Son los clásicos mohos verde y azul. Ninguno de dichos patógenos puede atacar a la fruta si no tiene heridas en su superficie y difícilmente se propagan por contacto, si los frutos no presentan lesiones en su corteza.

Penicillium italicum - digitatum citricos

El Penicillium Digitatum tiene un desarrollo fácil a 20 ºC y humedad relativa alta. El Penicillium Italicum puede crecer entre 3 y 32 ºC, aunque se desarrolla con más facilidad a 24 ºC y humedad relativa alta.

Ambos hongos, pueden permanecer durante meses sobre la piel y desarrollarse posteriormente, en cuanto entran en contacto con los líquidos liberados por las heridas de la corteza.

Penicillium italicum - digitatum citricos

Una vez asentados en la fruta, sus hifas blanquecinas excretan un enzima que deshace la lignina de la corteza reblandeciendo los tejidos.

FUENTES DE INFECCIÓN

Las esporas procedentes del suelo, los envases, el aire, la línea de tratamiento, etc.

Penicillium italicum - digitatum citricos

CONTAMINACIÓN

La contaminación de los frutos, se produce siempre por esporas, que se instalan en las heridas de la piel. En el caso del Penicillium Italicum, también puede producirse la contaminación por contacto con frutos podridos, ya que las hifas pueden atravesar la piel de un fruto sano, en determinadas circunstancias.

Penicillium italicum - digitatum citricos

VARIEDADES SUSCEPTIBLES

Todas las variedades y en todas las épocas.

IDENTIFICACIÓN

Aparición sobre el fruto de una zona blanda humedecida que se extiende progresivamente. Dicha zona se cubre de un moho blanco, que es la parte vegetativa del hongo.

Aparecen las esporas de color verde o azuladas características.

Penicillium italicum - digitatum citricos

Los frutos atacados por Penicillium Digitatum, se adhieren fuertemente a las superficies con las que están en contacto.

Si la humedad es alta, otros hongos y bacterias se asientan sobre el fruto, que se aplasta hacia el interior, y se descompone la masa del fruto.

Penicillium italicum – digitatum citricos

Debido a que están apareciendo resistencias del moho azul a varios productos, indicaremos como puede distinguirse sobre los frutos; al inicio del podrido que es cuando realmente es difícil su distinción.

En el podrido causado por el moho verde, no es tan húmedo como el del moho azul. El área podrida es más firme y más lisa cuando se trata de moho azul.

MEZCLAS DE PENICILLIUM DIGITATUM y PENICILLIUM ITALICUM

Dichas mezclas se producen frecuentemente. El moho verde aparece, muchas veces, después de que el moho azul se ha instalado sobre el fruto, con lo que se produce una mezcla en la que las esporas de color verde predominan en poco tiempo.

Penicillium italicum - digitatum citricos

La mezcla produce normalmente una decoloración rosada o rojiza en el tejido de la corteza, en el que se han mezclado los hongos.

La presencia de los dos podridos se puede detectar por esta decoloración.

Los métodos de control son esencialmente los mismos para los dos tipos de hongos.

Penicillium italicum - digitatum citricos

ALTERNARIA CITRI

Este tipo de podrido aparece con más frecuencia en limones, navels y marisoles, etc. que en el resto de los cítricos.

alternaria citri en citricosLas esporas del hongo, transportadas por el viento llegan a los pedúnculos o a los ombligos, cuando los frutos son pequeños y permanecen latentes o germinan y penetran hacia el interior si la temperatura y humedad son idóneas.

alternaria citri en citricos

Los frutos sanos son resistentes a este tipo de podrido.

El ataque de este hongo se produce principalmente:

  • – Sobre frutos débiles.
  • – Cuando el fruto está expuesto a temperaturas bajas y prolongadas.
  • – Cuando el fruto ha sufrido quemaduras de sol.
  • – En períodos de vientos secos.
  • – Cuando existe un deterioro interno del fruto.

IDENTIFICACIÓN

alternaria citri en citricosEn la fruta almacenada, el podrido comienza normalmente por el pedúnculo en el caso de los limones y en los ombligos en el caso de navels y marisoles, etc. El podrido avanza por el corazón de la misma, produciendo un podrido central interno, que se hace visible al exterior como una mancha negra, próxima al ombligo. Lo difícil es detectarlo en su inicio ya que el único indicador externo de Alternaria, es la diferencia de color de los frutos afectados, que es más intenso en los frutos enfermos que en los sanos de una misma partida.

alternaria citri en citricos

En conservación frigorífica, si la temperatura es próxima a cero grados aparece una mancha marrón que va aumentando de color hasta el marrón oscuro.

Por ello, en las mesas de selección, todos aquellos frutos que tengan un color sobresaliente respecto al resto, hay que cogerlos y apretarlos ligeramente, si ceden pueden estar afectados de Alternaria y en cualquier caso son frutos para el destrío.

alternaria citri en citricosalternaria citri en citricos

Abriendo la fruta por la mitad se observa perfectamente el podrido marrón oscuro-negro.

MEDIDAS PREVENTIVAS

  • 1. Procurar comprar frutos fuertes, tratados en campo contra esta enfermedad.
  • 2. No dejar que la fruta madure totalmente en el árbol.
  • 3. Utilizar los mínimos de temperatura, humedad y tiempo al desverdizar la fruta, si se utiliza etileno.
  • 4. Eliminar las frutas que tengan síntomas de Alternaria.

BOTRYTIS CINEREA

Con frecuencia el podrido debido a Botrytis, comienza con el contacto de los frutos con pequeños trozos de materia orgánica, extendiéndose posteriormente por el resto del fruto. También puede asentarse el hongo, por la base del pedúnculo, sobre todo en los frutos cogidos a “tirón”.

Botritis cinerea citricosBotritis cinerea citricosPara el desarrollo de la Botrytis sobre los frutos, es necesario que estos tengan heridas en su corteza, favoreciendo dicho desarrollo los largos períodos de tiempo húmedo, con temperaturas bajas o moderadas.

Botritis cinerea citricos

La Botrytis aparece con frecuencia en los frutos almacenados en cámaras frigoríficas debido a una incorrecta conservación. La humedad excesiva y la aireación deficiente son las causas fundamentales.

Botritis cinerea citricos

IDENTIFICACIÓN

La Botrytis es un podrido duro, coriáceo, de color pardo-marrón que posteriormente, en atmósfera húmeda, se cubre con masas de esporas grises de aspecto algodonoso.

Botritis cinerea citricos

MEDIDAS PREVENTIVAS

  • Botritis cinerea citricos1. Evitar tener los cajones en el campo con tiempo húmedo.
  • 2. Prevenir las heridas.
  • 3. Evitar la humedad excesiva en el almacenamiento.
  • 4. Desinfectar las cajas que hayan tenido frutos podridos.

 

GEOTRICHUM CANDIDUM

Este tipo de podrido es más importante cada día, debido a su resistencia a la mayoría de los productos utilizados en los almacenes.

GEOTRICHUM CANDIDUM

Es un hongo que se instala en los frutos por heridas. Se da con frecuencia este tipo de podrido sobre fruta madura con defectos y almacenada durante algún tiempo. Hongos del tipo Penicillium instalados sobre podrido de Geotrichum, aceleran la total descomposición de los frutos atacados.

GEOTRICHUM CANDIDUM

IDENTIFICACIÓN

Es un podrido blando, con un olor agrio especial, que atrae a las moscas de la fruta que depositan sus huevos sobre las masas podridas. Con el tiempo dichas masas gotean infectando las frutas próximas.

MEDIDAS PREVENTIVAS

  • 1. Evitar todo tipo de heridas.
  • 2. Inmersión de la fruta durante 1-2 minutos en soluciones de ortofenil fenol al 0,8-1 %, manteniendo el pH entre 11,5 y 11,7.
  • 3. Inspección frecuente de la fruta eliminando los frutos atacados por el hongo.

PHYTOPHTHORA CITROPHTHORA

Este hongo es el causante del podrido marrón de los agrios.

Es una enfermedad de campo, donde la lluvia es el vehículo para las esporas hasta los frutos más bajos del árbol.

PHYTOPHTHORA CITROPHTHORA

Es un hongo de penetración directa, no necesita la existencia de heridas para su desarrollo.

El podrido debido a Phytphthora es particularmente grave en los casos de abundantes lluvias o largos períodos de humedades elevadas.

IDENTIFICACIÓN

El podrido marrón de los cítricos es firme, coriáceo y, si las condiciones ambientales le son favorables, sobre las manchas marrones aparece un moho blanco. Los frutos atacados por Phytophthora desprenden un olor a rancio característico, que es la única forma de distinguir este podrido en su inicio, en las mesas de selección.

PHYTOPHTHORA CITROPHTHORAMEDIDAS PREVENTIVAS

  • 1. Sumergir la fruta durante 2-4 minutos en agua caliente o soluciones fungicidas calientes (46-49 ºC). Es una solución técnica pero no es práctica y en la actualidad no se usa.
  • 2. Recolectar, después de un período de lluvias únicamente los frutos situados en la mitad superior del árbol.
  • 3. Dejar los frutos en el árbol, después de las lluvias 2-3 días hasta que la Phytophthora se manifieste con claridad y no recolectar los frutos afectados.
  • 4. Los frutos deben conservarse en almacén dos días como mínimo, entre la recogida y la manipulación.
  • 5. Separar los frutos que hayan tenido contacto, con otros atacados de Phytophthora.

PHYTOPHTHORA CITROPHTHORA

LIMONES: Normas de acondicionamiento

Los frutos recolectados durante o a continuación de un período de viento húmedo, deben permanecer en el almacén de 36 a 48 horas antes de cualquier tratamiento o manipulación.

Si los limones se recolectan después de lluvias, es necesario secarlos en almacén como mínimo 4 días antes de cualquier tratamiento o manipulación.

Los limones no deben lavarse nunca en soluciones a temperaturas superiores a los 38 ºC.

PHOMOPSIS

Según las zonas, el podrido es de escasa importancia y se manifiesta sobre los frutos débiles en el almacenaje.

El grado de infección varía con la madurez del fruto y la humedad presente, y puede ser grave en la fruta desverdizada.

Phomopsis

IDENTIFICACIÓN

Es un podrido firme, aunque flexible, en la zona peduncular.

Normalmente se inicia con blandeamientos y decoloraciones débiles, entorno al botón peduncular, cambiando de marrón a pardo y aumentando la flexibilidad.

Phomopsis

En el interior, el podrido es de color ligeramente marrón, avanzando más rápidamente a lo largo del centro del fruto que por la porción exterior de la corteza.

MEDIDAS PREVENTIVAS

  • 1. Recoger la fruta antes de la sobremaduración.
  • 2. Tratamientos fungicidas en almacén con ortfenil fenato sódico al 1%, manteniendo el pH entre 11,5 y 11,7.
  • 3. Almacenar la fruta a temperaturas bajas (8-10 ºC), para retrasar el desarrollo del hongo.
  • 4. Confeccionar la fruta lo más pronto posible después de la recolección.

Phomopsis

DIPLODIA

El ataque de Diplodia se produce por heridas de cualquier tipo.

Este hongo se ve igualmente en naranjas, pomelos y limones durante el período de almacenaje.

Las heladas, temperaturas muy altas, situaciones de exceso de humedad y ataques de insectos son las causas que favorecen la instalación del hongo.

IDENTIFICACIÓN

Aparece alrededor del pedúnculo una decoloración a la que sigue un ablandamiento de la zona y una tonalidad marrón.

La parte interior de la zona afectada es de color oscuro, más acusado en el caso de Phomopsis.

El podrido se extiende en forma de aro a partir del pezón.

MEDIDAS PREVENTIVAS

  • 1. Recoger la fruta antes de la sobremaduración.
  • 2. Tratamientos fungicidas en almacén con ortfenil fenato sódico al 1%, manteniendo el pH entre 11,5 y 11,7.
  • 3. Almacenar la fruta a temperaturas bajas (8-10 ºC), para retrasar el desarrollo del hongo.
  • 4. Confeccionar la fruta lo más pronto posible después de la recolección.

RHIZOPUS NIGRICANS

Este hongo afecta a todas las especies y variedades de agrios. Entre las causas que favorecen su desarrollo, citaremos, el poco cuidado en el manejo de los cajones en el campo, los frutos heridos, chafados o aplastados en el transporte y la entrada a cámara sin una selección previa. No puede propagarse si no hay heridas en los frutos y es habitual la formación de “nidos”.

IDENTIFICACIÓN

Es una podredumbre blanda, con pérdida de líquidos, la corteza adquiere una coloración marrón. A temperaturas superiores a 10 ºC, los frutos son recubiertos con abundante micelio de color blanquecino, que origina unas largas hifas terminadas en unos puntitos negros, que son las esporas.

Rhizopus

MEDIDAS PREVENTIVAS

  • 1. Efectuar un buen manejo de los frutos.
  • 2. Realizar una buena selección.
  • 3. Utilizar cámaras y cajones limpios de restos de materia orgánica.
  • 4. Conservar los frutos a temperaturas no superiores a 5 ºC.

Rhizopus

TRICHOTECIUM ROSEUM

Afecta principalmente a naranjas y mandarinas y es una podredumbre lenta.

Favorecen el desarrollo de este patógeno, las heridas, rameados, “manchas de agua”, el coger la fruta a “tirón”, etc.

trichotecium roseum

A temperaturas inferiores a 10 ºC, no se desarrolla, pero no muere, pudiendo más tarde en condiciones idóneas, iniciar de nuevo su actividad.

Este hongo puede producir dos tipos de podredumbres, una superficial que se observa en frutos almacenados en frigorífico más de 30 días y otra interna, por penetración del hongo a través de la zona peduncular o estilar (W. Navel).

trichotecium roseum

Su transmisión se realiza por heridas y contacto.

IDENTIFICACIÓN

Podredumbre superficial: en ambientes húmedos y zonas deprimidas del flavedo, aparece un ligero moho blanquecino, que poco a poco adquiere una tonalidad rosa. El tejido afectado adquiere un color marrón claro, de consistencia blanda y con olor a tejido fermentado.

Podredumbre interna: el hongo produce una podredumbre blanda, de sabor amargo y da a los tejidos un color oscuro, si sale al exterior la piel afectada adquiere un color marrón claro.

MEDIDAS PREVENTIVAS

1. Realizar una buena selección y cuidar el manejo de la fruta.

2. Si los frutos se conservan en cámara, mantener alta la humedad relativa de la misma.

COLLETOTRICHUM GLOEOSPORIOIDES

Afecta a todas las especies y variedades pero sobre todo a clementinas y satsumas al ser desverdizadas.

COLLETOTRICHUM GLOEOSPORIOIDES

Puede localizarse en cualquier zona del fruto, pero es más frecuente en la zona estilar y peduncular.

Favorecen el desarrollo, todos aquellos factores, que afectan a la calidad de la corteza del fruto, como escasa profundidad del suelo y baja calidad del mismo, problemas nutritivos, problemas de riego (agua con exceso de sal), etc.

COLLETOTRICHUM GLOEOSPORIOIDES

En el desverdizado el gas etileno influye positivamente en el desarrollo del hongo.

IDENTIFICACIÓN

Es un podrido firme y flexible, que produce en la corteza un color marrón, llegando a ser oscuro o negro. El hongo ataca los tejidos del fruto descomponiéndolos y produciendo un fuerte olor a moho.

Las esporas se encuentran debajo de la cutícula del fruto y se ven como puntos negros y en condiciones de elevada humedad, salen al exterior formando unas masas blanco-amarillentas.

MEDIDAS PREVENTIVAS

  • 1. Evitar durante el desverdizado las pérdidas de agua de los frutos, ya que sobre frutos turgescentes el hongo no es capaz de actuar.
  • 2. No recolectar frutos con rocío.
  • 3. Evitar todo tipo de heridas en la manipulación de los mismos.

FUSARIUM OXYSPORUM

Este podrido afecta a todas las especies y variedades, principalmente a naranjas y mandarinas.

Favorecen el desarrollo del hongo: la lluvia, el rocío, el granizo, los golpes, las rozaduras y, en general, todo aquello que debilite o rompa la corteza.

Su transmisión es por heridas, afectando principalmente la zona estilar y peduncular, en especial esta última si los frutos son cogidos “a tirón”.

IDENTIFICACIÓN

Si afecta a la corteza de los frutos origina una podredumbre seca, flexible y de color marrón. En ambiente húmedo produce un micelio blanco o blanco-grisáceo.

Si afecta a zonas internas del fruto, produce una podredumbre blanda con desarrollo miceliar de coloración rosada o amarillenta.

La corteza de los frutos atacados adquiere una tonalidad marrón claro.

MEDIDAS PREVENTIVAS

Realizar una cuidadosa selección y manejo de la fruta ya que la calidad de la corteza es limitante en el desarrollo del hongo.

CLADOSPORIUM HERBARUM

Afecta a todas las especies y variedades cultivadas.

Entre las causas que favorecen su desarrollo destacaremos:

  • – Rozaduras, golpes, lesiones producidas por plaguicidas, rameado, etc.
  • – Oleocelosis y envejecimiento.
  • – Granizo, helada, rocío, niebla.
  • – Lesiones producidas en los frutos por insectos y ácaros.

La zona de ataque del hongo es, normalmente, la peduncular y estilar, pero no ataca la pulpa del fruto.

Si los frutos están muy maduros, puede penetrar por los tejidos del pedúnculo y provocar una podredumbre seca del eje central.

IDENTIFICACIÓN

Es una podredumbre seca, firme y flexible, que afecta principalmente a las zonas peduncular y estilar. Las zonas atacadas por el hongo, se oscurecen rápidamente y hay un crecimiento micelar de color verde grisáceo.

Afecta únicamente a la corteza del fruto, produciendo unas depresiones más o menos acentuadas a nivel de flavedo.

MEDIDAS PREVENTIVAS

Efectuar un buen manejo de los frutos y una buena selección, ya que la calidad de la corteza es limitante en el crecimiento del hongo .

TRICHODERMA

Este tipo de podredumbre puede producir elevadas pérdidas en el almacenamiento de frutos (sobre todo en limones) debido a que suele ir acompañada de otras podredumbres.

Este hongo crece hacia el interior de la madera de las cajas de almacenamiento lo cual es una fuente de reinfección.

IDENTIFICACIÓN

Es un podrido firme, de color marrón (antes de la invasión de otros hongos). Las masas de esporas son de coloración gris y, normalmente, este podrido desprende un agradable olor a coco.

MEDIDAS PREVENTIVAS

  • 1. Eliminar los frutos contaminados.
  • 2. Desinfectar todos los cajones que hayan tenido frutos podridos.

 

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.7/5 (15 votes cast)
VN:F [1.9.22_1171]
Rating: +4 (from 8 votes)

Reduccion de patogenos en los almacenes

Reduccion de patogenos en los almacenes

Uno de los objetivos comunes en la postcosecha, tanto de investigadores como comerciantes y exportadores es reduccion de patogenos en los almacenes en general.

De alguna manera, hay que intentar solucionar este problema, ya que son muchos los patógenos en los almacenes y los productos autorizados, se hallan reducidos a:

Benzimidazoles

  • – Thiabendazol
  • – Metiltiofanato (sólo en baño, drencher o fumígeno)

Imidazoles

  • – Imazalil
  • – Procloraz (sólo en baño o drencher)

Fenoles

  • – Ortofenilfenato sódico
  • – Ortofenilfenol (fumígeno)

Detergentes

  • – Detergente alcalino
  • – Detergente neutro
  • – Detergente + Ortofenilfenol
  • – Detergente + Guazatina

Lo cual nos lleva a la conclusión, de que la correcta aplicación de cada uno de ellos o sus mezclas, así como las técnicas de aplicación, van a jugar un papel importante en el control de los problemas que nos ocupan.

Por otra parte, las infecciones que nos llegan de campo en cuanto a P. digitatum y P. italicum no alcanzan la media de 10 esporas por fruto de ambos, lo que equivale en función del tamaño del fruto a menos de 1 espora por cm2. La probabilidad de que dichas esporas produzcan podridos es muy baja, si se logra en los almacenes, reducir el número de esporas en el ambiente, mediante medidas de limpieza y desinfección.

Con el lavado de los cítricos, en postcosecha, se eliminan la mayor parte de las esporas de la corteza y si al agua de lavado se le añade ortofenilfenato sódico (SOPP), los frutos quedan prácticamente libres de esporas, pero se vuelven a contaminar durante la manipulación y empaquetado de los mismos.

El lavado de los frutos, sin ningún tipo de fungicida, antes de la aplicación de etileno durante el desverdizado, reduce la población de hongos en los frutos y la incidencia concreta de Antracnosis y Diplodia, el lavado solo, no reduce los podridos producidos por Phomopsis, Penicillium y Geotrichum, aumentando con ello el riesgo de Phytophthora.

Por otra parte, el flavedo es la primera línea de resistencia a la invasión inicial de las podredumbres. Las heridas producidas durante la recolección, el transporte y la manipulación, que producen la rotura del flavedo, son los puntos en los que se realiza la infección de hongos como Penicillium, Geotrichum y Trichoderma.

Las microheridas y las infecciones incipientes, pueden erradicarse con fungicidas efectivos, aplicados lo antes posible después de la recolección, los frutos verdes, como ya comentamos, tienen además, sus propios sistemas de defensa.

En frutos de corteza gruesa, pomelos, limones y naranjas, heridas de una profundidad de 0,5 – 1 mm tienen, si se tratan, alta resistencia a la invasión por Penicillium; mientras que heridas de 3 mm de profundidad, sin solución, producen podrido en el 100% de los frutos afectados.

En mandarinas, heridas de profundidad de 1 mm suelen ser suficientes para que se produzca el podrido irreversible. Está demostrado que el aumento de podrido por Penicillium en Navels y Valencias, está directamente relacionado, con el nivel de daños producidos durante la recolección y manipulación en el almacén.

Se ha investigado y comprobado, que la aplicación en campo de 2,4 – D ó 2,4,5 – T, incrementan el tiempo de stock de los frutos en condiciones, retardan las senescencia del “botón” peduncular de los cítricos y tienen, aunque débil, actividad contra Alternaria.

Erickson et al. demostraron que el albedo (zona blanca e interna de la corteza de los frutos) en limones inmaduros, posee una considerable resistencia a la invasión de Alternaria, que disminuye con el tiempo de stock y que la aplicación de 2,4 – D retrasa la pérdida de esa resistencia.

En los casos de aplicación de 2,4 – D en campo, se recomienda su utilización, en forma de ester isopropílico y no de sus sales porque:

  • Los ésteres, tienen ligera volatilidad.
  • Tienen una mejor distribución sobre los frutos
  • Dejan residuos muy bajos

Por otra parte el 2,4 – D, controla Diplodia y Phomopsis en naranjas y Penicillium, Alternaria y Colletotrichum en mandarinas (Loest et al., Lodh et al.).

En poscosecha se utiliza habitualmente la sal amina del 2,4 – D.

Las temperaturas bajas y la humedad relativa alta, ayudan a mantener la resistencia de la piel y del “botón” peduncular a la infección del fruto.

Las temperaturas bajas mantienen la calidad del fruto, retrasando el desarrollo de las infecciones, pero el control y posible erradicación de las mismas, debe realizarse con tratamientos químicos adecuados.

.

LA REDUCCIÓN DE PATÓGENOS, MEDIANTE TRATAMIENTOS EN CAMPO

El control de algunos podridos postcosecha, debe realizarse, antes de la recolección de los cítricos, sobre todo de aquellos patógenos, que son difíciles de controlar en los almacenes.

Uno de los que pueden producir daños elevados en postcosecha es Phytophthora. En este caso, deben realizarse tratamientos preventivos al suelo y a las “faldas” del árbol, que son las zonas más propensas a la infección.

La aplicación de cobre, normalmente en forma de sulfato, a las citadas “faldas” y a la zona de goteo del árbol, antes de las primeras lluvias protege a los frutos, de la infección de Phytophthora.

En la actualidad, se utilizan con más frecuencia, productos como el Fosetil-Al (Aliette), para la masa foliar del árbol y Metalaxil (Ridomil), para la aplicación al suelo, si bien pueden utilizarse solos para ambas partes.

.

REDUCCIÓN DE PATÓGENOS EN POSTCOSECHA

La desinfección y los tratamientos postcosecha, reducen el podrido de los frutos cítricos, porque:

  • – Destruyen los inóculos de los patógenos, en la superficie del fruto y su entorno.
  • – Inhiben el desarrollo incipiente de infecciones de Diplodia, Alternaria y Phytophthora, que hay debajo de la superficie del fruto, cuando estos se recolectan.
  • – Previenen la infección por heridas de patógenos, como Penicillium digitatum, P. itálicum, Geotrichum cándidum y Trichoderma.
  • – Protegen la superficie de los frutos, contra infecciones, sobre nuevas heridas, por la manipulación de los mismos después de los tratamientos fungicidas.
  • – Inhiben la esporulación de Penicillium spp.

La desinfección, se ha convertido en los últimos años, en el mejor camino para controlar en los almacenes Geotrichum y esporas de Penicillium resistentes a los diversos fungicidas, tanto en los frutos como en el ambiente.

La desinfección a base de cloroforos (compuestos que aportan cloro) destruyen el 98% de las esporas de Penicillium digitatum que puedan haber en la superficie de los frutos, en pocos segundos (15), a bajas concentraciones 200 ppm y a un pH del agua de disolución de 7.

Recordamos que la actividad de los cloroforos se debe a HOCl (ácido hipocloroso) y que el Cl¯ no tiene actividad ni contra hongos ni bacterias (Eckert, J.)

El Imazalil, aplicado vía agua, penetra la cutícula del fruto y controla las infecciones de Penicillium, mejor, que aplicado con la cera y proporciona mayor protección, a dosis de 500 mg/L, controla todos los aislados ensayados. IMZ a 2000 ppm + 1% SOPP, aplicado con la cera, tiene mejor control sobre Geotrichum, que cualquiera de los dos solos. La mezcla de IMZ+2,4-D proporciona mejores resultados, que si se utilizan separadamente, contra Alternaria.

.

RESISTENCIAS DE LOS PATÓGENOS

La frecuencia y repetición cada vez a dosis más altas, ha provocado una serie de resistencias, de diferentes patógenos, a los productos más utilizados en los almacenes. Este es el origen de cepas de Penicillium resistentes al TBZ y el Benomilo, en las distintas variedades de cítricos.

Las mayores resistencias de Penicillium en satsumas, están provocadas por la aplicación repetitiva del metiltiofanato.

Otra de las causas de las resistencias, a los productos químicos de los Penicillium, es la rapidez de su reproducción, en muchos casos y la multitud de nuevas esporas que dispersan las corrientes de aire procedentes de frutos podridos y esporulados.

Las esporas resistentes de los diversos patógenos, se multiplican rápidamente en los frutos tratados, con productos a los que se han hecho resistentes.

La aplicación en los almacenes, de desinfectantes FUMÍGENOS, es la forma más práctica de reducir las esporas en el ambiente, de los almacenes, ya que por sus características, es la única capaz, de realizar una buena desinfección, de forma sencilla y práctica.

Desafortunadamente, de todas las familias de productos mencionadas en el capítulo anterior, no todos los productos están autorizados, por diferentes razones.

Nuevas técnicas y nuevos productos, se irán desarrollando para mejorar el control de determinados patógenos como Alternaria, Botrytis, etc.

El éxito de los productos actuales y los que puedan llegar al mercado, debe ir acompañado de:

  • – Frutos fisiológicamente sanos, recolectados con cuidado y transportados a los almacenes, en las debidas condiciones.
  • – Minimización del incremento de inóculos en los almacenes, utilizando la limpieza y desinfección, ya que el número de esporas en los almacenes, resistentes a los tratamientos autorizados, crece en relación al número total de esporas en los mismos.
  • – El stock y el transporte deben ser óptimos, para mantener la vitalidad de los frutos.

Los tratamientos fungicidas, nunca debe intentarse, que sustituyan a los puntos anteriores, algo que sí ocurre, con más frecuencia de la deseada.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Trichoderma viride en citricos – podridos de almacen

Trichoderma viride en citricos – podridos de almacen

Este tipo de podredumbre – Trichoderma viride – puede producir elevadas pérdidas en el almacenamiento de frutos (sobre todo en limones) debido a que suele ir acompañada de otras podredumbres.

Trichoderma es un género de hongos que está presente en todos los suelos, donde están los hongos cultivables más prevalentes. Muchas especies de este género pueden ser caracterizados como oportunistas.

Trichoderma harzianum

Este hongo crece hacia el interior de la madera de las cajas de almacenamiento lo cual es una fuente de reinfección.

IDENTIFICACIÓN

Es un podrido firme, de color marrón (antes de la invasión de otros hongos). Las masas de esporas son de coloración gris y, normalmente, este podrido desprende un agradable olor a coco.

MEDIDAS PREVENTIVAS

  1. Eliminar los frutos contaminados.
  2. Desinfectar todos los cajones que hayan tenido frutos podridos.

Empleo de Trichoderma sp. para el control de lesiones causadas por Phytophthora sp. en troncos y ramas en árboles de pomelo Ruby Red

Después del raspado realizado como forma de cura de los chancros producidos por Phytophthora sp. en troncos y ramas de plantas de pomelo Ruby Red, se probaron los efectos en el control de la enfermedad de un tratamiento a base de Aliette y uno utilizando una suspensión de esporas de Trichoderma sp. como tratamiento biológico. Después de dos meses de tratamiento se observó la cura del 100 % de los chancros tanto en el tratamiento con Aliette como en el realizado con la aplicación del antagonista.

La lucha biológica consiste en la introducción artificial de microorganismos antagonistas en el patosistema, para controlar el patógeno y favorecer a la planta reduciendo el inóculo o la intensidad de los síntomas posteriores a la infección (Sutton, 1998). Es de gran importancia la aplicación de los métodos de control biológico para el control de los patógenos que afectan a los cultivos ya que es necesario reducir el empleo de productos químicos que dañan el medio ambiente (Hebb y Sonada, 1992).

Smith y otros (1990) encontraron que especies de Trichoderma sp. producían gran cantidad de sustancias fungostáticas contra diversos hongos del género Phytophthora sp. Las especies del género Trichoderma sp. se utilizan como agentes de control biológico, porque son fáciles de aislar y cultivar, crecen rápidamente en muchos sustratos, afectan raramente a plantas superiores, producen antibióticos y presentan una alta efectividad antagónica e hiperparásita; por lo que son capaces de destruir las paredes celulares y el interior de las células del hongo fitopatógeno debido a su actividad enzimática que reduce su desarrollo y provoca su destrucción (Powell, 1993).

El control biológico con Trichoderma sp. se puede llevar a cabo según Jensen (1992) de la manera siguiente: se introduce el antagonista en el suelo, por tratamiento a las semillas y por aplicación a partes aéreas de la planta. El objetivo del presente trabajo fue determinar la efectividad del hongo Trichoderma en el control de chancros producidos por Phytophthora sp. en troncos y ramas de cítricos aplicado después del tratamiento de raspado.

CONCLUSIONES
1. La aplicación de Aliette como fungicida protectante para la cura de la gomosis resultó efectiva en todas las plantas evaluadas, mientras que el tratamiento curativo en que se utilizó Trichoderma sp. resultó efectivo para el control de Phytophthora sp. en cítricos, después de 120 días del tratamiento, independientemente del tamaño de los chancros.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.3/5 (3 votes cast)
VN:F [1.9.22_1171]
Rating: +1 (from 3 votes)

Cladosporium herbarum en citricos

Cladosporium herbarum en citricos

Cladosporium herbarum afecta a todas las especies y variedades cultivadas.

Entre las causas que favorecen su desarrollo destacaremos:

  • – Rozaduras, golpes, lesiones producidas por plaguicidas, rameado, etc.
  • – Oleocelosis y envejecimiento.
  • – Granizo, helada, rocío, niebla.
  • – Lesiones producidas en los frutos por insectos y ácaros.

La zona de ataque del hongo es, normalmente, la peduncular y estilar, pero no ataca la pulpa del fruto.

Cladosporium herbarum en citricos

Si los frutos están muy maduros, puede penetrar por los tejidos del pedúnculo y provocar una podredumbre seca del eje central.

IDENTIFICACIÓN

Es una podredumbre seca, firme y flexible, que afecta principalmente a las zonas peduncular y estilar. Las zonas atacadas por el hongo, se oscurecen rápidamente y hay un crecimiento micelar de color verde grisáceo.

Afecta únicamente a la corteza del fruto, produciendo unas depresiones más o menos acentuadas a nivel de flavedo.

MEDIDAS PREVENTIVAS

Efectuar un buen manejo de los frutos y una buena selección, ya que la calidad de la corteza es limitante en el crecimiento del hongo .

GENERALIDADES

Cladosporium, es uno de los géneros más grandes de hyphomycetes, con más de 772 especies y teleomorfos en Davidiella (Braun et al., 2003; Dugan et al., 2004; Schubert  et al.,  2007). Las especies de  Cladosporium son comunes y ampliamente distribuidas, incluyendo especies endófitas, patógenas en humanos, patógenas en plantas y saprofitas. Las especies saprofitas ocurren en tallos y hojas senescentes y muertas de plantas herbaceas y leñosas, como invasores secundarios de manchas foliares necróticas, y son frecuentemente aisladas de aire, suelo, productos alimenticios, pintura, textiles y otros materiales orgánicos (Riesen y  Sieber 1985, Brown et al., 1998, El-Morsy, 2000; Crous et al., 2007a).

Cladosporium herbarum

En los últimos años un concepto moderno de Cladosporium ha sido establecido basado en exámenes morfológicos y análisis moleculares. De esta manera, estudios taxonómicos siguiendo una aproximación polifásica han sido conducidos para definir distintas especies dentro de  Cladosporium (Schubert y Braun 2004; Heuchert et al., 2005; Schubert, 2005a, b; Braun et al., 2006, 2008a, Caracterización etiológica de la Roña de la gulupa Pasiflora edulis Sims. en la región del Sumapaz 19 b; Crous et al., 2006; Schubert et al., 2006; Braun y Schubert 2007; Crous et al., 2007a,b; Arzanlou et al., 2007; Schubert et al., 2007; Zalar et al., 2007; Schubert et al., 2009; Bensch et al., 2010).

Los hongos del género Cladosporium producen colonias efusas u ocasionalmente  punctiformes, a menudo de color verde oliva pero también algunas veces gris, café o marrón oscuro, de textura aterciopelada,  flocosa o  vellosa y con micelio inmerso o superficial. Estroma algunas veces presente,  setas e hifopodios ausentes, conidióforos macronematosos o semimacronematosos y algunas veces también micronematosos; los conidióforos  macronematosos pueden ser rectos o flexuosos, principalmente sin ramificar o con ramificaciones restringidas a la región apical formando un estípite y cabeza, de color café o café oliva; con ornamentación de pared lisa o verrucosa, ramoconidias a menudo presentes, con células conidiógenas poliblásticas, usualmente integradas, algunas veces discretas, simpodiales, más o menos cilíndricas, con cicatrices usualmente prominentes. Las conidias son catenadas, pero algunas veces  son solitarias, especialmente en especies con muchas conidias, a menudo en cadenas ramificadas,  acropleurógenas, simple cilíndrica, doliforme, elipsoidal, fusiforme, ovoide, esférica o subesférica, con una distinguible y protuberante cicatriz en cada extremo o justo en la base, café oliva oscuro a  pálido o café, liso, verruculosa o equinulada, con 0-3 u ocasionalmente más septos.

Parámetros para la definición de especies dentro de Cladosporium.
Tipo de caracterización
Nivel de caracterización Procedimientos
Morfológica
Macroscópica
Evaluación del diámetro de colonias crecidas en PDA (Papa dextrosa Agar), AEM (Agar Extracto de Malta) y AA (Agar Harina de Avena) a 25°C. al día 14.
Evaluación del color de las colonias crecidas  en los tres medios de cultivo al día 14.
Microscópica
Determinación de los patrones de ramificación de conidióforos.
Determinación del ancho y largo de 30 ramoconidias, conidias intercalar y terminales a un aumento de 1.000x.
Estudios de microscopía de barrido electrónico para definir la ornamentación de pared de conidias y conidióforos.
Molecular
ITS ITS1: TCCGTAGGTGAACCTGCGG Amplificación y alineamiento de secuencias para definir el complejo de especies sensu lato.
LR5: ATCCTGAGGGAAACTTC
Actina 512F: ATGTGCAAGGCCGGTTTCGC
Amplificación y alineamiento de secuencias para definir especies  sensu estricto dentro de los complejos de especies  sensu lato.
783R: TACGAGTCCTTCTGGCCCAT
Factor de elongaci ón 1 alfa
728F: CATCGAGAAGTTCGAGAAGG
986R: TACTTGAAGGAACCCTTACC
Calmodulina
228F: GAGTTCAAGGAGGCCTTCTCCC
737R: CATCTTTCTGGCCATCATGG
Histona
H3
H3-1a: ACTAAGCAGACCGCCCGCAGG
H31b: GCGGGCGAGCTGGATGTCCTT

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Fusarium oxysporum en citricos

Fusarium oxysporum en citricos

Fusarium oxysporum afecta a todas las especies y variedades, principalmente a naranjas y mandarinas.

Favorecen el desarrollo del hongo: la lluvia, el rocío, el granizo, los golpes, las rozaduras y, en general, todo aquello que debilite o rompa la corteza.

Fusarium en citricos

Su transmisión es por heridas, afectando principalmente la zona estilar y peduncular, en especial esta última si los frutos son cogidos “a tirón”.

IDENTIFICACIÓN

Si afecta a la corteza de los frutos origina una podredumbre seca, flexible y de color marrón. En ambiente húmedo produce un micelio blanco o blanco-grisáceo.

Fusarium en citricos

Si afecta a zonas internas del fruto, produce una podredumbre blanda con desarrollo miceliar de coloración rosada o amarillenta.

La corteza de los frutos atacados adquiere una tonalidad marrón claro.

MEDIDAS PREVENTIVAS

Realizar una cuidadosa selección y manejo de la fruta ya que la calidad de la corteza es limitante en el desarrollo del hongo.

GENERALIDADES

Fusarium oxysporum f. sp. phaseoli es el agente que causa  la enfermedad conocida como amarillamiento por Fusarium o marchitamiento por Fusarium. Invade y deteriora el sistema vascular de la planta, que por ello se marchita y, finalmente, muere .
El hongo penetra en la planta por las raíces, invade luego algunos vasos del xilema y pronto tapona todo el sistema vascular. El primer síntoma es un amarillamiento, más adelante se observa la marchitez de las hojas por falta de nutrientes y, por último, la defoliación de la planta.

Fusarium oxysporum se aísla de tejidos vegetales que presenten síntomas típicos de la enfermedad, es decir, de la raíz y de parte del hipocotilo. Generalmente, el hongo infecta estas dos estructuras de la planta.

Para recolectar las muestras de tejido infectado en el campo, se necesitan tres elementos: toallas de papel, bolsas de papel y rótulos para identificar las muestras.

Las siglas PDA corresponden a los componentes del medio: papa, dextrosa y agar. Este medio se usa para aislar éste y otros patógenos.

Materiales
– PDA deshidratado  39 g/litro
– Agua destilada  1 litro
– Frascos erlenmeyer de 1000 ml 2
– Cajas petri  50

Preparación
– Se pesan los ingredientes, se colocan en un recipiente grande, que puede ser un vaso de
precipitado, y se les agrega el agua; esta solución se envasa en dos frascos erlenmeyer (500 ml en cada uno).
– Los frascos erlenmeyer con el medio de cultivo PDA se esterilizan en autoclave. Esta máquina, con una presión de 20 libras y una temperatura de 121 °C, realiza el proceso total de esterilización en 40 minutos.
– El medio esterilizado se deja enfriar hasta que pueda manipularse, y se vierte luego en cajas petri, a razón de 20 ml por caja.

C. Aislamientos de F. oxysporum
1. En el medio de cultivo PDA

Materiales
– Cámara de flujo laminar
– Tijeras
– Cajas petri, de 100 y 60 mm
– Agua destilada estéril
– Hipoclorito de sodio al 2.5%
– Toallas de papel
– Mechero
– Marcador
– Incubadora
– Medio de cultivo PDA
– Pinzas
– Muestra vegetal con síntomas
Nota: Todos los procedimientos se deben ejecutar dentro de la cámara de flujo laminar; además, deben cumplirse todas las condiciones de asepsia y esterilidad que se exigen en un laboratorio. En otras palabras, se aplican siempre las buenas prácticas microbiológicas

(BPM).
Pasos del proceso
•  Paso 1
Cortar varios trozos del tejido enfermo utilizando una tijera estéril.
•  Paso 2
Desinfectar los trozos de muestra en una caja petri de 60 mm que contenga una solución de hipoclorito de sodio al 2.5%, durante 3 minutos. Enjuagar luego los trozos desinfectados con agua destilada estéril en otra caja petri, vertiendo el agua sobre la muestra con una pipeta estéril.
•  Paso 3
Colocar los trozos lavados sobre toallas de papel estériles durante 10 minutos para que se sequen.
• Paso 4
Cuando los trozos estén secos, tomarlos con una pinza estéril y ‘sembrarlos’ en una caja petri que contenga el medio de cultivo PDA. Hacer lo mismo con las demás cajas (para multiplicar las muestras). Incubar las cajas a 24 °C durante 7 días, tiempo en que el hongo producirá masas de conidias y micelio.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.5/5 (2 votes cast)
VN:F [1.9.22_1171]
Rating: +2 (from 4 votes)
Proudly using Dynamic Headers by Nicasio WordPress Design