Trichoderma viride en citricos – podridos de almacen

Trichoderma viride en citricos – podridos de almacen

Este tipo de podredumbre – Trichoderma viride – puede producir elevadas pérdidas en el almacenamiento de frutos (sobre todo en limones) debido a que suele ir acompañada de otras podredumbres.

Trichoderma es un género de hongos que está presente en todos los suelos, donde están los hongos cultivables más prevalentes. Muchas especies de este género pueden ser caracterizados como oportunistas.

Trichoderma harzianum

Este hongo crece hacia el interior de la madera de las cajas de almacenamiento lo cual es una fuente de reinfección.

IDENTIFICACIÓN

Es un podrido firme, de color marrón (antes de la invasión de otros hongos). Las masas de esporas son de coloración gris y, normalmente, este podrido desprende un agradable olor a coco.

MEDIDAS PREVENTIVAS

  1. Eliminar los frutos contaminados.
  2. Desinfectar todos los cajones que hayan tenido frutos podridos.

Empleo de Trichoderma sp. para el control de lesiones causadas por Phytophthora sp. en troncos y ramas en árboles de pomelo Ruby Red

Después del raspado realizado como forma de cura de los chancros producidos por Phytophthora sp. en troncos y ramas de plantas de pomelo Ruby Red, se probaron los efectos en el control de la enfermedad de un tratamiento a base de Aliette y uno utilizando una suspensión de esporas de Trichoderma sp. como tratamiento biológico. Después de dos meses de tratamiento se observó la cura del 100 % de los chancros tanto en el tratamiento con Aliette como en el realizado con la aplicación del antagonista.

La lucha biológica consiste en la introducción artificial de microorganismos antagonistas en el patosistema, para controlar el patógeno y favorecer a la planta reduciendo el inóculo o la intensidad de los síntomas posteriores a la infección (Sutton, 1998). Es de gran importancia la aplicación de los métodos de control biológico para el control de los patógenos que afectan a los cultivos ya que es necesario reducir el empleo de productos químicos que dañan el medio ambiente (Hebb y Sonada, 1992).

Smith y otros (1990) encontraron que especies de Trichoderma sp. producían gran cantidad de sustancias fungostáticas contra diversos hongos del género Phytophthora sp. Las especies del género Trichoderma sp. se utilizan como agentes de control biológico, porque son fáciles de aislar y cultivar, crecen rápidamente en muchos sustratos, afectan raramente a plantas superiores, producen antibióticos y presentan una alta efectividad antagónica e hiperparásita; por lo que son capaces de destruir las paredes celulares y el interior de las células del hongo fitopatógeno debido a su actividad enzimática que reduce su desarrollo y provoca su destrucción (Powell, 1993).

El control biológico con Trichoderma sp. se puede llevar a cabo según Jensen (1992) de la manera siguiente: se introduce el antagonista en el suelo, por tratamiento a las semillas y por aplicación a partes aéreas de la planta. El objetivo del presente trabajo fue determinar la efectividad del hongo Trichoderma en el control de chancros producidos por Phytophthora sp. en troncos y ramas de cítricos aplicado después del tratamiento de raspado.

CONCLUSIONES
1. La aplicación de Aliette como fungicida protectante para la cura de la gomosis resultó efectiva en todas las plantas evaluadas, mientras que el tratamiento curativo en que se utilizó Trichoderma sp. resultó efectivo para el control de Phytophthora sp. en cítricos, después de 120 días del tratamiento, independientemente del tamaño de los chancros.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.3/5 (3 votes cast)
VN:F [1.9.22_1171]
Rating: +1 (from 3 votes)

Cladosporium herbarum en citricos

Cladosporium herbarum en citricos

Cladosporium herbarum afecta a todas las especies y variedades cultivadas.

Entre las causas que favorecen su desarrollo destacaremos:

  • – Rozaduras, golpes, lesiones producidas por plaguicidas, rameado, etc.
  • – Oleocelosis y envejecimiento.
  • – Granizo, helada, rocío, niebla.
  • – Lesiones producidas en los frutos por insectos y ácaros.

La zona de ataque del hongo es, normalmente, la peduncular y estilar, pero no ataca la pulpa del fruto.

Cladosporium herbarum en citricos

Si los frutos están muy maduros, puede penetrar por los tejidos del pedúnculo y provocar una podredumbre seca del eje central.

IDENTIFICACIÓN

Es una podredumbre seca, firme y flexible, que afecta principalmente a las zonas peduncular y estilar. Las zonas atacadas por el hongo, se oscurecen rápidamente y hay un crecimiento micelar de color verde grisáceo.

Afecta únicamente a la corteza del fruto, produciendo unas depresiones más o menos acentuadas a nivel de flavedo.

MEDIDAS PREVENTIVAS

Efectuar un buen manejo de los frutos y una buena selección, ya que la calidad de la corteza es limitante en el crecimiento del hongo .

GENERALIDADES

Cladosporium, es uno de los géneros más grandes de hyphomycetes, con más de 772 especies y teleomorfos en Davidiella (Braun et al., 2003; Dugan et al., 2004; Schubert  et al.,  2007). Las especies de  Cladosporium son comunes y ampliamente distribuidas, incluyendo especies endófitas, patógenas en humanos, patógenas en plantas y saprofitas. Las especies saprofitas ocurren en tallos y hojas senescentes y muertas de plantas herbaceas y leñosas, como invasores secundarios de manchas foliares necróticas, y son frecuentemente aisladas de aire, suelo, productos alimenticios, pintura, textiles y otros materiales orgánicos (Riesen y  Sieber 1985, Brown et al., 1998, El-Morsy, 2000; Crous et al., 2007a).

Cladosporium herbarum

En los últimos años un concepto moderno de Cladosporium ha sido establecido basado en exámenes morfológicos y análisis moleculares. De esta manera, estudios taxonómicos siguiendo una aproximación polifásica han sido conducidos para definir distintas especies dentro de  Cladosporium (Schubert y Braun 2004; Heuchert et al., 2005; Schubert, 2005a, b; Braun et al., 2006, 2008a, Caracterización etiológica de la Roña de la gulupa Pasiflora edulis Sims. en la región del Sumapaz 19 b; Crous et al., 2006; Schubert et al., 2006; Braun y Schubert 2007; Crous et al., 2007a,b; Arzanlou et al., 2007; Schubert et al., 2007; Zalar et al., 2007; Schubert et al., 2009; Bensch et al., 2010).

Los hongos del género Cladosporium producen colonias efusas u ocasionalmente  punctiformes, a menudo de color verde oliva pero también algunas veces gris, café o marrón oscuro, de textura aterciopelada,  flocosa o  vellosa y con micelio inmerso o superficial. Estroma algunas veces presente,  setas e hifopodios ausentes, conidióforos macronematosos o semimacronematosos y algunas veces también micronematosos; los conidióforos  macronematosos pueden ser rectos o flexuosos, principalmente sin ramificar o con ramificaciones restringidas a la región apical formando un estípite y cabeza, de color café o café oliva; con ornamentación de pared lisa o verrucosa, ramoconidias a menudo presentes, con células conidiógenas poliblásticas, usualmente integradas, algunas veces discretas, simpodiales, más o menos cilíndricas, con cicatrices usualmente prominentes. Las conidias son catenadas, pero algunas veces  son solitarias, especialmente en especies con muchas conidias, a menudo en cadenas ramificadas,  acropleurógenas, simple cilíndrica, doliforme, elipsoidal, fusiforme, ovoide, esférica o subesférica, con una distinguible y protuberante cicatriz en cada extremo o justo en la base, café oliva oscuro a  pálido o café, liso, verruculosa o equinulada, con 0-3 u ocasionalmente más septos.

Parámetros para la definición de especies dentro de Cladosporium.
Tipo de caracterización
Nivel de caracterización Procedimientos
Morfológica
Macroscópica
Evaluación del diámetro de colonias crecidas en PDA (Papa dextrosa Agar), AEM (Agar Extracto de Malta) y AA (Agar Harina de Avena) a 25°C. al día 14.
Evaluación del color de las colonias crecidas  en los tres medios de cultivo al día 14.
Microscópica
Determinación de los patrones de ramificación de conidióforos.
Determinación del ancho y largo de 30 ramoconidias, conidias intercalar y terminales a un aumento de 1.000x.
Estudios de microscopía de barrido electrónico para definir la ornamentación de pared de conidias y conidióforos.
Molecular
ITS ITS1: TCCGTAGGTGAACCTGCGG Amplificación y alineamiento de secuencias para definir el complejo de especies sensu lato.
LR5: ATCCTGAGGGAAACTTC
Actina 512F: ATGTGCAAGGCCGGTTTCGC
Amplificación y alineamiento de secuencias para definir especies  sensu estricto dentro de los complejos de especies  sensu lato.
783R: TACGAGTCCTTCTGGCCCAT
Factor de elongaci ón 1 alfa
728F: CATCGAGAAGTTCGAGAAGG
986R: TACTTGAAGGAACCCTTACC
Calmodulina
228F: GAGTTCAAGGAGGCCTTCTCCC
737R: CATCTTTCTGGCCATCATGG
Histona
H3
H3-1a: ACTAAGCAGACCGCCCGCAGG
H31b: GCGGGCGAGCTGGATGTCCTT

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Fusarium oxysporum en citricos

Fusarium oxysporum en citricos

Fusarium oxysporum afecta a todas las especies y variedades, principalmente a naranjas y mandarinas.

Favorecen el desarrollo del hongo: la lluvia, el rocío, el granizo, los golpes, las rozaduras y, en general, todo aquello que debilite o rompa la corteza.

Fusarium en citricos

Su transmisión es por heridas, afectando principalmente la zona estilar y peduncular, en especial esta última si los frutos son cogidos “a tirón”.

IDENTIFICACIÓN

Si afecta a la corteza de los frutos origina una podredumbre seca, flexible y de color marrón. En ambiente húmedo produce un micelio blanco o blanco-grisáceo.

Fusarium en citricos

Si afecta a zonas internas del fruto, produce una podredumbre blanda con desarrollo miceliar de coloración rosada o amarillenta.

La corteza de los frutos atacados adquiere una tonalidad marrón claro.

MEDIDAS PREVENTIVAS

Realizar una cuidadosa selección y manejo de la fruta ya que la calidad de la corteza es limitante en el desarrollo del hongo.

GENERALIDADES

Fusarium oxysporum f. sp. phaseoli es el agente que causa  la enfermedad conocida como amarillamiento por Fusarium o marchitamiento por Fusarium. Invade y deteriora el sistema vascular de la planta, que por ello se marchita y, finalmente, muere .
El hongo penetra en la planta por las raíces, invade luego algunos vasos del xilema y pronto tapona todo el sistema vascular. El primer síntoma es un amarillamiento, más adelante se observa la marchitez de las hojas por falta de nutrientes y, por último, la defoliación de la planta.

Fusarium oxysporum se aísla de tejidos vegetales que presenten síntomas típicos de la enfermedad, es decir, de la raíz y de parte del hipocotilo. Generalmente, el hongo infecta estas dos estructuras de la planta.

Para recolectar las muestras de tejido infectado en el campo, se necesitan tres elementos: toallas de papel, bolsas de papel y rótulos para identificar las muestras.

Las siglas PDA corresponden a los componentes del medio: papa, dextrosa y agar. Este medio se usa para aislar éste y otros patógenos.

Materiales
– PDA deshidratado  39 g/litro
– Agua destilada  1 litro
– Frascos erlenmeyer de 1000 ml 2
– Cajas petri  50

Preparación
– Se pesan los ingredientes, se colocan en un recipiente grande, que puede ser un vaso de
precipitado, y se les agrega el agua; esta solución se envasa en dos frascos erlenmeyer (500 ml en cada uno).
– Los frascos erlenmeyer con el medio de cultivo PDA se esterilizan en autoclave. Esta máquina, con una presión de 20 libras y una temperatura de 121 °C, realiza el proceso total de esterilización en 40 minutos.
– El medio esterilizado se deja enfriar hasta que pueda manipularse, y se vierte luego en cajas petri, a razón de 20 ml por caja.

C. Aislamientos de F. oxysporum
1. En el medio de cultivo PDA

Materiales
– Cámara de flujo laminar
– Tijeras
– Cajas petri, de 100 y 60 mm
– Agua destilada estéril
– Hipoclorito de sodio al 2.5%
– Toallas de papel
– Mechero
– Marcador
– Incubadora
– Medio de cultivo PDA
– Pinzas
– Muestra vegetal con síntomas
Nota: Todos los procedimientos se deben ejecutar dentro de la cámara de flujo laminar; además, deben cumplirse todas las condiciones de asepsia y esterilidad que se exigen en un laboratorio. En otras palabras, se aplican siempre las buenas prácticas microbiológicas

(BPM).
Pasos del proceso
•  Paso 1
Cortar varios trozos del tejido enfermo utilizando una tijera estéril.
•  Paso 2
Desinfectar los trozos de muestra en una caja petri de 60 mm que contenga una solución de hipoclorito de sodio al 2.5%, durante 3 minutos. Enjuagar luego los trozos desinfectados con agua destilada estéril en otra caja petri, vertiendo el agua sobre la muestra con una pipeta estéril.
•  Paso 3
Colocar los trozos lavados sobre toallas de papel estériles durante 10 minutos para que se sequen.
• Paso 4
Cuando los trozos estén secos, tomarlos con una pinza estéril y ‘sembrarlos’ en una caja petri que contenga el medio de cultivo PDA. Hacer lo mismo con las demás cajas (para multiplicar las muestras). Incubar las cajas a 24 °C durante 7 días, tiempo en que el hongo producirá masas de conidias y micelio.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.5/5 (2 votes cast)
VN:F [1.9.22_1171]
Rating: +2 (from 4 votes)

Colletotrichum gloeosporioides

Colletotrichum gloeosporioides afecta a todas las especies y variedades pero sobre todo a clementinas y satsumas al ser desverdizadas.

Colletotrichum gloeosporioides en citricos

Puede localizarse en cualquier zona del fruto, pero es más frecuente en la zona estilar y peduncular.

Favorecen el desarrollo, todos aquellos factores, que afectan a la calidad de la corteza del fruto, como escasa profundidad del suelo y baja calidad del mismo, problemas nutritivos, problemas de riego (agua con exceso de sal), etc.

En el desverdizado el gas etileno influye positivamente en el desarrollo del hongo.

IDENTIFICACIÓN

Es un podrido firme y flexible, que produce en la corteza un color marrón, llegando a ser oscuro o negro. El hongo ataca los tejidos del fruto descomponiéndolos y produciendo un fuerte olor a moho.

Colletotrichum gloeosporioides en citricos

Las esporas se encuentran debajo de la cutícula del fruto y se ven como puntos negros y en condiciones de elevada humedad, salen al exterior formando unas masas blanco-amarillentas.

MEDIDAS PREVENTIVAS

  1. Evitar durante el desverdizado las pérdidas de agua de los frutos, ya que sobre frutos turgescentes el hongo no es capaz de actuar.
  2. No recolectar frutos con rocío.
  3. Evitar todo tipo de heridas en la manipulación de los mismos.

SÍNTOMAS Y SIGNOS

Los síntomas de la antracnosis de los cítricos incluyen muerte de las ramitas, la caída prematura de las hojas y manchas oscuras en la fruta y descomposición de frutas  en poscosecha. Hojas muertas y retorcidas comenzarán a cubrirse de manchas oscuras producidas por  esporas del hongo por los cuales se propaga el patógeno.

La antracnosis puede manchar el tejido de la corteza de Valencias y las naranjas navel y ocasionalmente variedades de limón. El trastorno afecta principalmente a la fruta en los árboles estresados y ​​con madera vieja muerta.

COMENTARIOS SOBRE LA ENFERMEDAD

El hongo de la antracnosis generalmente infecta a las ramas débiles. La enfermedad es más común durante las primaveras con períodos húmedos prolongados y cuando se producen lluvias importantes adelantadas. Durante la lluvia o niebla, las esporas de antracnosis gotean sobre los frutos, donde infectan la piel y deja marcas de color variante de rojizo a verde a rayas en la fruta inmadura y rayas desde marrón a negro en la fruta madura. La antracnosis se acompaña a menudo con una mancha Septoria. Las manchas no se pueden lavar, pero el trastorno no suele ser lo suficientemente grave como para requerir acciones preventivas. En ciertas condiciones, sin embargo, como las aplicaciones de jabones insecticidas, que dañan la cera protectora en la piel de la fruta, puede aumentar la gravedad de esta enfermedad.

 GESTIÓN

Si el tratamiento es  necesario, hacer que las aplicaciones en otoño que se dirijan a todo el árbol. Una buena cobertura es importante.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 4.0/5 (1 vote cast)
VN:F [1.9.22_1171]
Rating: +1 (from 1 vote)

Trichotecium roseum

Trichotecium roseum principalmente a naranjas y mandarinas y es una podredumbre lenta.

Favorecen el desarrollo de este patógeno, las heridas, rameados, “manchas de agua”, el coger la fruta a “tirón”, etc.

Trichotecium roseum en citricos

A temperaturas inferiores a 10 ºC, no se desarrolla, pero no muere, pudiendo más tarde en condiciones idóneas, iniciar de nuevo su actividad.

Este hongo puede producir dos tipos de podredumbres, una superficial que se observa en frutos almacenados en frigorífico más de 30 días y otra interna, por penetración del hongo a través de la zona peduncular o estilar (W. Navel).

Su transmisión se realiza por heridas y contacto.

IDENTIFICACIÓN

Podredumbre superficial: en ambientes húmedos y zonas deprimidas del flavedo, aparece un ligero moho blanquecino, que poco a poco adquiere una tonalidad rosa. El tejido afectado adquiere un color marrón claro, de consistencia blanda y con olor a tejido fermentado.

Trichotecium roseum en citricos

Podredumbre interna: el hongo produce una podredumbre blanda, de sabor amargo y da a los tejidos un color oscuro, si sale al exterior la piel afectada adquiere un color marrón claro.

MEDIDAS PREVENTIVAS

  1. Realizar una buena selección y cuidar el manejo de la fruta.
  2. Si los frutos se conservan en cámara, mantener alta la humedad relativa de la misma.
VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Rhizopus Nigricans

Rhizopus nigricans afecta a todas las especies y variedades de agrios. Entre las causas que favorecen su desarrollo, citaremos, el poco cuidado en el manejo de los cajones en el campo, los frutos heridos, chafados o aplastados en el transporte y la entrada a cámara sin una selección previa. No puede propagarse si no hay heridas en los frutos y es habitual la formación de “nidos”.

Rhizopus en citricos

IDENTIFICACIÓN

Es una podredumbre blanda, con pérdida de líquidos, la corteza adquiere una coloración marrón. A temperaturas superiores a 10 ºC, los frutos son recubiertos con abundante micelio de color blanquecino, que origina unas largas hifas terminadas en unos puntitos negros, que son las esporas.

Rhizopus en citricos

MEDIDAS PREVENTIVAS

  1. Efectuar un buen manejo de los frutos.
  2. Realizar una buena selección.
  3. Utilizar cámaras y cajones limpios de restos de materia orgánica.
  4. Conservar los frutos a temperaturas no superiores a 5 ºC.

Rhizopus Lind
Sinónimos: Mucor niger Gedoelst, M. stolonifer Ehrenb., R. nigricans Ehrenb., R. niger
Ciaglinski & Hewelke, R. artocarpi Raciborski.
Taxonomía: Reino Fungi, Filo Zygomycota (División Eumycota, Subdivisión Zygomycotina, Clase Zygomyctetes)
Descripción: Zigosporas globosas, de 103-108 μm de diámetro, de color marrón oscuro
y de pared gruesa e irregular. Esporangióforos aseptados, de color marrón claro y sin ramificar, de unas 34 μm de diámetro y de 1000-3500 μm de longitud. Esporangios globosos con la base aplanada, de color blanco al principio, después negro. Esporangiosporas
no flageladas, redondeadas, de color marrón oscuro y de 8-20 μm de diámetro.
Huéspedes: Muy polífago.
Sintomatología: Causa una podredumbre blanda, húmeda y de color marrón pálido en los frutos de muchos vegetales. Penetra en el huésped a través de heridas y se desarrolla preferentemente en frutos maduros.
Referencias:
– Hernández-Hernández, J.M., Sala-Tamayo, L. (1989). Trials for the control of postharvest rots (Rhizopus stolonifer) of papaya in the Canary Islands. Acta Horticulturae 258: 317-320.
– Lunn, J. A. (1977). Rhizopus stolonifer. CMI Descriptions of Pathogenic Fungi and Bacteria nº 524.
– Usall, J., Viñas, I. (2000). Podredumbre causada por Rhizopus. En “Montesinos, E. et
al. (edit.): Enfermedades de los frutales de pepita y hueso”: 92-94. Mundi- PrensaSEF. 147 pp.

Rhizopus stolonifer (Ehrenb.) Lind
Sinónimos: Mucor niger Gedoelst, M. stolonifer Ehrenb., R. nigricans Ehrenb., R. niger
Ciaglinski & Hewelke, R. artocarpi Raciborski.
Taxonomía: Reino Fungi, Filo Zygomycota (División Eumycota, Subdivisión Zygomycotina, Clase Zygomyctetes)
Descripción: Zigosporas globosas, de 103-108 μm de diámetro, de color marrón oscuro
y de pared gruesa e irregular. Esporangióforos aseptados, de color marrón claro y sin ramificar, de unas 34 μm de diámetro y de 1000-3500 μm de longitud. Esporangios globosos con la base aplanada, de color blanco al principio, después negro. Esporangiosporas
no flageladas, redondeadas, de color marrón oscuro y de 8-20 μm de diámetro.
Huéspedes: Muy polífago.
Sintomatología: Causa una podredumbre blanda, húmeda y de color marrón pálido en
los frutos de muchos vegetales. Penetra en el huésped a través de heridas y se desarrolla
preferentemente en frutos maduros.
Referencias:
– Hernández-Hernández, J.M., Sala-Tamayo, L. (1989). Trials for the control of postharvest rots (Rhizopus stolonifer) of papaya in the Canary Islands. Acta Horticulturae 258: 317-320.
– Lunn, J. A. (1977). Rhizopus stolonifer. CMI Descriptions of Pathogenic Fungi and
Bacteria nº 524.
– Usall, J., Viñas, I. (2000). Podredumbre causada por Rhizopus. En “Montesinos, E. et
al. (edit.): Enfermedades de los frutales de pepita y hueso”: 92-94. Mundi- PrensaSEF. 147 pp.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 2.0/5 (1 vote cast)
VN:F [1.9.22_1171]
Rating: +1 (from 1 vote)

Diplodia natalensis

Diplodia natalensis en Citricos

El ataque de Diplodia natalensis se produce por heridas de cualquier tipo.

Este hongo se ve igualmente en naranjas, pomelos y limones durante el período de almacenaje.

Diplodia en citricos

Las heladas, temperaturas muy altas, situaciones de exceso de humedad y ataques de insectos son las causas que favorecen la instalación del hongo.

IDENTIFICACIÓN

Aparece alrededor del pedúnculo una decoloración a la que sigue un ablandamiento de la zona y una tonalidad marrón.

Diplodia en citricos

La parte interior de la zona afectada es de color oscuro, más acusado en el caso de Phomopsis.

Diplodia en citricosEl podrido se extiende en forma de aro a partir del pezón.

MEDIDAS PREVENTIVAS

  1. Recoger la fruta antes de la sobremaduración.
  2. Tratamientos fungicidas en almacén con ortfenil fenato sódico al 1%, manteniendo el pH entre 11,5 y 11,7.
  3. Almacenar la fruta a temperaturas bajas (8-10 ºC), para retrasar el desarrollo del hongo.
  4. Confeccionar la fruta lo más pronto posible después de la recolección.

Aparición e importancia:

La podredumbre del pedúnculo es una enfermedad importante de poscosecha en regiones cálidas y húmedas, el desarrollo de la enfermedad se ver incrementado por la producción de etileno, que se utiliza para mejorar la coloración de la cáscara en las regiones donde la coloración natural se ve retrasada por las elevadas temperaturas.

Síntomas y enfermedades alternativas:

La podredumbre del pedúnculo es raro observarla en la fruta que está todavía en el árbol, incluso cuando está madura.

Después de cosechar, los síntomas aparecen en dos semanas cuando las temperaturas superan los 21°C. los hongos se activan en el pedúnculo y rápidamente penetran en la cáscara y avanza hacia los laterales de la fruta. No hay crecimiento de hongos en la superficie de la fruta.

Ocasionalmente, la decaída se desarrolla en las heridas del lateral o del pedúnculo de la fruta. El progreso del hongo es muy rápido a través del eje central esponjoso de la fruta, normalmente alcanzando el extremo mucho más pronto pr es ruta que por la cáscara.

A diferencia de la podredumbre causada por Fomosis, el decaimiento irregularmente a través de la cáscara, de modo que produce proyecciones como un dedo de tejido marrón. Típicamente, el decaimiento aparece tanto en el pedúnculo como en la base y antes de envolver a toda la fruta.

El tejido decaído es inicialmente firme y después se vuelve húmedo y pesado. La superficie del micelio aparece solo en etapas avanzadas de infección en ambientes muy húmedos. La decaída normalmente no se dispersa de la fruta infectada a la sana en los envases.

Ciclo de la enfermedad:

Diplodia natalensis es un saprófito que completa su ciclo vital en las ramitas muertas.

Los hongos normalmente no invaden la fruta después de la cosecha, y no produce la apertura natural para permitir la penetración.

Normalmente, este hongo no produce esporulación en la fruta infectada, los conidios se producen en mayor número que las ascoesporas. Los conidios son dispersados solo a cortas distancias pro la lluvia que salpica, mientras que las ascoesporas son arrastradas por el viento y son las responsables de la dispersión a largas distancias a los árboles plantados recientemente.

La incidencia de la enfermedad es mayor en las frutas que se recolectan pronto en la estación cuando las temperaturas ambientales altas favorecen el crecimiento de los hongos y las fruta puede generar etileno. El tratamiento de etileno causa la abscisión temprana del botón, facilitando así la entrada de los hongos.

Las temperaturas elevadas (próximas a 30°C) y las altas elevadas humedades relativas (92-96%) usadas en el proceso son favorables para el desarrollo de la enfermedad.

Control:

Buenas prácticas culturales pueden ayudar en le control de la podredumbre causada por Diplodia produciendo árboles económicos con pocas cantidades de Madera muerta. La cosecha por tirón mayor que por truncamiento, puede reducir la incidencia del marchitamiento.

Refrigerar inmediatamente después de envasar retrasa el desarrollo de la podredumbre del pedúnculo; el marchitamiento es casi completamente inhibido a 10°C.

La aplicación de fungicidas de imazalil en la poscosecha proporcione un buen control de este tipo de podredumbre. Los tratamientos pueden se aplicados antes del drenching de los palets de la fruta recolectada con soluciones o suspensiones de fungicidas.

Aparición e importancia: 

La podredumbre del pedúnculo es una enfermedad importante de poscosecha en regiones cálidas y húmedas, el desarrollo de la enfermedad se ver incrementado por la producción de etileno, que se utiliza para mejorar la coloración de la cáscara en las regiones donde la coloración natural se ve retrasada por las elevadas temperaturas.

Síntomas y enfermedades alternativas:

La podredumbre del pedúnculo es raro observarla en la fruta que está todavía en el árbol, incluso cuando está madura.

Después de cosechar, los síntomas aparecen en dos semanas cuando las temperaturas superan los 21°C. los hongos se activan en el pedúnculo y rápidamente penetran en la cáscara y avanza hacia los laterales de la fruta. No hay crecimiento de hongos en la superficie de la fruta.

 

Ocasionalmente, la decaída se desarrolla en las heridas del lateral o del pedúnculo de la fruta. El progreso del hongo es muy rápido a través del eje central esponjoso de la fruta, normalmente alcanzando el extremo mucho más pronto pr es ruta que por la cáscara.

 

A diferencia de la podredumbre causada por Fomosis, el decaimiento irregularmente a través de la cáscara, de modo que produce proyecciones como un dedo de tejido marrón. Típicamente, el decaimiento aparece tanto en el pedúnculo como en la base y antes de envolver a toda la fruta.

 

El tejido decaído es inicialmente firme y después se vuelve húmedo y pesado. La superficie del micelio aparece solo en etapas avanzadas de infección en ambientes muy húmedos. La decaída normalmente no se dispersa de la fruta infectada a la sana en los envases.

Ciclo de la enfermedad:

Diplodia natalensis es un saprófito que completa su ciclo vital en las ramitas muertas. 
Los hongos normalmente no invaden la fruta después de la cosecha, y no produce la apertura natural para permitir la penetración.

Normalmente, este hongo no produce esporulación en la fruta infectada, los conidios se producen en mayor número que las ascoesporas. Los conidios son dispersados solo a cortas distancias pro la lluvia que salpica, mientras que las ascoesporas son arrastradas por el viento y son las responsables de la dispersión a largas distancias a los árboles plantados recientemente.

La incidencia de la enfermedad es mayor en las frutas que se recolectan pronto en la estación cuando las temperaturas ambientales altas favorecen el crecimiento de los hongos y las fruta puede generar etileno. El tratamiento de etileno causa la abscisión temprana del botón, facilitando así la entrada de los hongos. 
Las temperaturas elevadas (próximas a 30°C) y las altas elevadas humedades relativas (92-96%) usadas en el proceso son favorables para el desarrollo de la enfermedad.

Control:

Buenas prácticas culturales pueden ayudar en le control de la podredumbre causada por Diplodia produciendo árboles económicos con pocas cantidades de Madera muerta. La cosecha por tirón mayor que por truncamiento, puede reducir la incidencia del marchitamiento.

Refrigerar inmediatamente después de envasar retrasa el desarrollo de la podredumbre del pedúnculo; el marchitamiento es casi completamente inhibido a 10°C.

La aplicación de fungicidas de imazalil en la poscosecha proporcione un buen control de este tipo de podredumbre. Los tratamientos pueden se aplicados antes del drenching de los palets de la fruta recolectada con soluciones o suspensiones de fungicidas.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Phomopsis citri

Phomopsis citri en citricos

Según las zonas, Phomopsis citri es de escasa importancia y se manifiesta sobre los frutos débiles en el almacenaje.

Phomopsis

El grado de infección varía con la madurez del fruto y la humedad presente, y puede ser grave en la fruta desverdizada.

IDENTIFICACIÓN

Es un podrido firme, aunque flexible, en la zona peduncular.

Phomopsis

Normalmente se inicia con blandeamientos y decoloraciones débiles, entorno al botón peduncular, cambiando de marrón a pardo y aumentando la flexibilidad.

Phomopsis

En el interior, el podrido es de color ligeramente marrón, avanzando más rápidamente a lo largo del centro del fruto que por la porción exterior de la corteza.

MEDIDAS PREVENTIVAS

  1. Recoger la fruta antes de la sobremaduración.
  2. Tratamientos fungicidas en almacén con ortfenilfenato sódico al 1%, manteniendo el pH entre 11,5 y 11,7.
  3. Almacenar la fruta a temperaturas bajas (8-10 ºC), para retrasar el desarrollo del hongo.
  4. Confeccionar la fruta lo más pronto posible después de la recolección.

Organismo que lo causa: Phomopsis citri = Diaporthe citri

Rango de acción: Todo tipo de cítricos son propensos a este marchitamiento.

Aparición e importancia:

La podredumbre del pedúnculo causada por Phomopsis es un marchitamiento serio. Es más prevalente en regiones subtropicales y tropicales que en áreas secas y frías donde crecen cítricos.

Síntomas y enfermedades alternativas:

La podredumbre del pedúnculo causada por Phomopsis ocurre tras la recolección durante el transporte o el almacenaje. Los hongos proceden de los tallos de los pedúnculos de las frutas y el centro axial, e invade los sacos de zumo.

En las etapas primarias, el marchitamiento no se distingue de La podredumbre del pedúnculo causada por Diplodia. Sin embargo, con la podredumbre del pedúnculo causada por Phomopsis el tejido infectado se contrae y una línea clara de demacración se forma en la unión de la corteza sana e infectada.

Ciclo de la enfermedad:

Phomopsis citri (Diaporthe citri) completa su ciclo como un saprófito en las ramas muertas y el inóculo se origina de esta substracción.

Los hongos producen ascoesporas (reproducción sexual), que producen melanosis y picnidioesporas (reproducción asexual), referido a Phomopsis citir, que produce podredumbre del pedúnculo causada por Phomopsis.

Las picnidioesporas, se producen de forma abundante sobre las ramas muertas con estructuras con forma de frasco (picnidios). Estos son dispersados a cortas distancias con un árbol o un árbol próximo por salpicadura de la lluvia.

Las esporas se pueden lavar de las ramas infectadas por la lluvia o el agua de riego dispersándolas a las hojas inferiores, fruta o tejidos de las ramas sanas del árbol.

Después de la recolección, los hongos entran en la fruta a través de aperturas naturales que se desarrollan en la fruta.

Control:

El control de la podredumbre del pedúnculo causada por Phomopsis es similar al de la podredumbre del pedúnculo causada por Diplodia.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 5.0/5 (1 vote cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Phytophthora citrophthora

Phytophthora citrophthora es el causante del podrido marrón de los agrios.

Phytophthora citrophthoraEs una enfermedad de campo, donde la lluvia es el vehículo para las esporas hasta los frutos más bajos del árbol.

Phytophthora citrophthoraEs un hongo de penetración directa, no necesita la existencia de heridas para su desarrollo.

Phytophthora citrophthoraEl podrido debido a Phytphthora es particularmente grave en los casos de abundantes lluvias o largos períodos de humedades elevadas.

Phytophthora citrophthora

IDENTIFICACIÓN

El podrido marrón de los cítricos es firme, coriáceo y, si las condiciones ambientales le son favorables, sobre las manchas marrones aparece un moho blanco. Los frutos atacados por Phytophthora desprenden un olor a rancio característico, que es la única forma de distinguir este podrido en su inicio, en las mesas de selección.

Phytophthora citrophthora

MEDIDAS PREVENTIVAS

  1. Sumergir la fruta durante 2-4 minutos en agua caliente o soluciones fungicidas calientes (46-49 ºC). Es una solución técnica pero no es práctica y en la actualidad no se usa.
  2. Recolectar, después de un período de lluvias únicamente los frutos situados en la mitad superior del árbol.
  3. Dejar los frutos en el árbol, después de las lluvias 2-3 días hasta que la Phytophthora se manifieste con claridad y no recolectar los frutos afectados.
  4. Los frutos deben conservarse en almacén dos días como mínimo, entre la recogida y la manipulación.
  5. Separar los frutos que hayan tenido contacto, con otros atacados de Phytophthora.

 Phytophthora citrophthora

LIMONES: Normas de acondicionamiento

Los frutos recolectados durante o a continuación de un período de viento húmedo, deben permanecer en el almacén de 36 a 48 horas antes de cualquier tratamiento o manipulación.

Si los limones se recolectan después de lluvias, es necesario secarlos en almacén como mínimo 4 días antes de cualquier tratamiento o manipulación.

Los limones no deben lavarse nunca en soluciones a temperaturas superiores a los 38 ºC.

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 0.0/5 (0 votes cast)
VN:F [1.9.22_1171]
Rating: 0 (from 0 votes)

Geotrichum candidum

Geotrichum candidum es más importante cada día, debido a su resistencia a la mayoría de los productos utilizados en los almacenes.

Geotrichum candidum

Es un hongo que se instala en los frutos por heridas. Se da con frecuencia este tipo de podrido sobre fruta madura con defectos y almacenada durante algún tiempo. Hongos del tipo Penicillium instalados sobre podrido de Geotrichum, aceleran la total descomposición de los frutos atacados.

Geotrichum candidum

IDENTIFICACIÓN

Es un podrido blando, con un olor agrio especial, que atrae a las moscas de la fruta que depositan sus huevos sobre las masas podridas. Con el tiempo dichas masas gotean infectando las frutas próximas.

 Geotrichum candidum

MEDIDAS PREVENTIVAS

  1. Evitar todo tipo de heridas.
  2. Inmersión de la fruta durante 1-2 minutos en soluciones de ortofenilfenol al 0,8-1 %, manteniendo el pH entre 11,5 y 11,7.
  3. Inspección frecuente de la fruta eliminando los frutos atacados por el hongo.

Geotrichum candidum

VN:F [1.9.22_1171]
Califica la calidad del articulo 1-5 GRACIAS
Rating: 5.0/5 (4 votes cast)
VN:F [1.9.22_1171]
Rating: +3 (from 3 votes)
Proudly using Dynamic Headers by Nicasio WordPress Design